FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626315_at:

>probe:Drosophila_2:1626315_at:371:561; Interrogation_Position=3226; Antisense; GGAAGCTGTTGGGTCGAAACGAATC
>probe:Drosophila_2:1626315_at:242:365; Interrogation_Position=3246; Antisense; GAATCGAAACACCACGTTGCCTTTG
>probe:Drosophila_2:1626315_at:316:627; Interrogation_Position=3263; Antisense; TGCCTTTGCCGCGAACAGCAAAATT
>probe:Drosophila_2:1626315_at:134:219; Interrogation_Position=3289; Antisense; AAGTGCTTTCTAAAACGTATTGCTA
>probe:Drosophila_2:1626315_at:637:433; Interrogation_Position=3315; Antisense; GAGGGAAACTAAGTGCACGCGTAAA
>probe:Drosophila_2:1626315_at:314:1; Interrogation_Position=3326; Antisense; AGTGCACGCGTAAAACAGTTAGGCT
>probe:Drosophila_2:1626315_at:13:509; Interrogation_Position=3386; Antisense; GTGTAGCATTCGTACTTTTTCGGTT
>probe:Drosophila_2:1626315_at:350:467; Interrogation_Position=3461; Antisense; GTTGTACTATATGTTTATCCTGGCA
>probe:Drosophila_2:1626315_at:570:477; Interrogation_Position=3473; Antisense; GTTTATCCTGGCAATTGAAGCGATT
>probe:Drosophila_2:1626315_at:88:207; Interrogation_Position=3490; Antisense; AAGCGATTTGTCGTGTTGCGAGTCC
>probe:Drosophila_2:1626315_at:32:515; Interrogation_Position=3502; Antisense; GTGTTGCGAGTCCTTGTCAATTGAT
>probe:Drosophila_2:1626315_at:45:373; Interrogation_Position=3605; Antisense; GAAGTTTCTGTAAAGTGCTGCCTGG
>probe:Drosophila_2:1626315_at:189:171; Interrogation_Position=3616; Antisense; AAAGTGCTGCCTGGGAAGTGGCCTT
>probe:Drosophila_2:1626315_at:514:171; Interrogation_Position=3728; Antisense; AAAGAACACCACACACAGTTGAAAT

Paste this into a BLAST search page for me
GGAAGCTGTTGGGTCGAAACGAATCGAATCGAAACACCACGTTGCCTTTGTGCCTTTGCCGCGAACAGCAAAATTAAGTGCTTTCTAAAACGTATTGCTAGAGGGAAACTAAGTGCACGCGTAAAAGTGCACGCGTAAAACAGTTAGGCTGTGTAGCATTCGTACTTTTTCGGTTGTTGTACTATATGTTTATCCTGGCAGTTTATCCTGGCAATTGAAGCGATTAAGCGATTTGTCGTGTTGCGAGTCCGTGTTGCGAGTCCTTGTCAATTGATGAAGTTTCTGTAAAGTGCTGCCTGGAAAGTGCTGCCTGGGAAGTGGCCTTAAAGAACACCACACACAGTTGAAAT

Full Affymetrix probeset data:

Annotations for 1626315_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720