Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626316_at:

>probe:Drosophila_2:1626316_at:177:139; Interrogation_Position=313; Antisense; ACGGTGCAGTCGTGCGTTAGCATTT
>probe:Drosophila_2:1626316_at:110:567; Interrogation_Position=384; Antisense; GGCACAGTTCGGTGATCACTACTAC
>probe:Drosophila_2:1626316_at:370:669; Interrogation_Position=403; Antisense; TACTACGAGCTGTTGTGGCGCAATC
>probe:Drosophila_2:1626316_at:209:237; Interrogation_Position=424; Antisense; AATCGTGTCGGTTTCGCCAAGGTGG
>probe:Drosophila_2:1626316_at:48:111; Interrogation_Position=488; Antisense; AGAATCTGCGCGAGGGCTTCCGTCA
>probe:Drosophila_2:1626316_at:47:645; Interrogation_Position=510; Antisense; TCAGGTGGGCATCTTTCGGACGTTC
>probe:Drosophila_2:1626316_at:695:555; Interrogation_Position=527; Antisense; GGACGTTCTTCATGCGACTGTACAA
>probe:Drosophila_2:1626316_at:444:223; Interrogation_Position=553; Antisense; AAGGTGCGCATACCGGTGTATCCCA
>probe:Drosophila_2:1626316_at:285:687; Interrogation_Position=601; Antisense; TTTCGGACGTATCTGGGCAAGCCTA
>probe:Drosophila_2:1626316_at:99:567; Interrogation_Position=616; Antisense; GGCAAGCCTATACCCTACGATGAGA
>probe:Drosophila_2:1626316_at:138:241; Interrogation_Position=663; Antisense; AATCAAGGTGACTCTCGGTTCATAT
>probe:Drosophila_2:1626316_at:364:473; Interrogation_Position=680; Antisense; GTTCATATACATCTATTGCCTGGCT
>probe:Drosophila_2:1626316_at:651:191; Interrogation_Position=721; Antisense; AACTTTGTGCAGGTGGCTACGGCTA
>probe:Drosophila_2:1626316_at:626:571; Interrogation_Position=735; Antisense; GGCTACGGCTATCGAGGATCTGATC

Paste this into a BLAST search page for me
ACGGTGCAGTCGTGCGTTAGCATTTGGCACAGTTCGGTGATCACTACTACTACTACGAGCTGTTGTGGCGCAATCAATCGTGTCGGTTTCGCCAAGGTGGAGAATCTGCGCGAGGGCTTCCGTCATCAGGTGGGCATCTTTCGGACGTTCGGACGTTCTTCATGCGACTGTACAAAAGGTGCGCATACCGGTGTATCCCATTTCGGACGTATCTGGGCAAGCCTAGGCAAGCCTATACCCTACGATGAGAAATCAAGGTGACTCTCGGTTCATATGTTCATATACATCTATTGCCTGGCTAACTTTGTGCAGGTGGCTACGGCTAGGCTACGGCTATCGAGGATCTGATC

Full Affymetrix probeset data:

Annotations for 1626316_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime