FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626318_at:

>probe:Drosophila_2:1626318_at:158:441; Interrogation_Position=19; Antisense; GATGGAGCAAGCAACATATACGAAT
>probe:Drosophila_2:1626318_at:541:149; Interrogation_Position=208; Antisense; ACTTCCTGGAGCAGCGGTCGCAACA
>probe:Drosophila_2:1626318_at:280:331; Interrogation_Position=221; Antisense; GCGGTCGCAACACCTCCTTAAGAGG
>probe:Drosophila_2:1626318_at:327:709; Interrogation_Position=238; Antisense; TTAAGAGGTGTGTCCACTGGTCTCC
>probe:Drosophila_2:1626318_at:498:119; Interrogation_Position=340; Antisense; AGCTGCGCGCCATTTAAGTCGCTGA
>probe:Drosophila_2:1626318_at:84:503; Interrogation_Position=357; Antisense; GTCGCTGACAAGTGTTTTGCCGGCA
>probe:Drosophila_2:1626318_at:392:289; Interrogation_Position=377; Antisense; CGGCATCTCCGGAATGCGACGGATA
>probe:Drosophila_2:1626318_at:373:391; Interrogation_Position=424; Antisense; GAAAGAATCGCCTGCTTCCATGGTT
>probe:Drosophila_2:1626318_at:234:61; Interrogation_Position=443; Antisense; ATGGTTCCTGCTGCCACAGAAGCCG
>probe:Drosophila_2:1626318_at:417:685; Interrogation_Position=45; Antisense; TATACGAACGCATTTATCGCCGCGC
>probe:Drosophila_2:1626318_at:358:205; Interrogation_Position=462; Antisense; AAGCCGCAGCAAAAAGTGGCAGCCA
>probe:Drosophila_2:1626318_at:270:521; Interrogation_Position=477; Antisense; GTGGCAGCCAACATTGCTACCAATT
>probe:Drosophila_2:1626318_at:157:299; Interrogation_Position=65; Antisense; CGCGCGGTCAGTCGTCGAAATGTTC
>probe:Drosophila_2:1626318_at:227:231; Interrogation_Position=83; Antisense; AATGTTCGAGATCCGGTCGTTTTGA

Paste this into a BLAST search page for me
GATGGAGCAAGCAACATATACGAATACTTCCTGGAGCAGCGGTCGCAACAGCGGTCGCAACACCTCCTTAAGAGGTTAAGAGGTGTGTCCACTGGTCTCCAGCTGCGCGCCATTTAAGTCGCTGAGTCGCTGACAAGTGTTTTGCCGGCACGGCATCTCCGGAATGCGACGGATAGAAAGAATCGCCTGCTTCCATGGTTATGGTTCCTGCTGCCACAGAAGCCGTATACGAACGCATTTATCGCCGCGCAAGCCGCAGCAAAAAGTGGCAGCCAGTGGCAGCCAACATTGCTACCAATTCGCGCGGTCAGTCGTCGAAATGTTCAATGTTCGAGATCCGGTCGTTTTGA

Full Affymetrix probeset data:

Annotations for 1626318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720