Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626319_a_at:

>probe:Drosophila_2:1626319_a_at:70:171; Interrogation_Position=1012; Antisense; AAAGGGATCCAGTTGCAGGTCATAT
>probe:Drosophila_2:1626319_a_at:666:265; Interrogation_Position=1021; Antisense; CAGTTGCAGGTCATATGCCTCCAAA
>probe:Drosophila_2:1626319_a_at:382:535; Interrogation_Position=1029; Antisense; GGTCATATGCCTCCAAAAAGTTCTG
>probe:Drosophila_2:1626319_a_at:193:339; Interrogation_Position=727; Antisense; GCTCAGCACTACTGAAACGGTTTCA
>probe:Drosophila_2:1626319_a_at:329:683; Interrogation_Position=831; Antisense; TATGAAATCTATATGCGCCCAGCGG
>probe:Drosophila_2:1626319_a_at:187:323; Interrogation_Position=845; Antisense; GCGCCCAGCGGACTTGAATTTGGTT
>probe:Drosophila_2:1626319_a_at:617:691; Interrogation_Position=881; Antisense; TTTGGCTAGGAGTAATATGCATATA
>probe:Drosophila_2:1626319_a_at:341:685; Interrogation_Position=904; Antisense; TATCTATACAAAACACGAGTGGCCC
>probe:Drosophila_2:1626319_a_at:159:295; Interrogation_Position=919; Antisense; CGAGTGGCCCGAACACTGTGTGAGA
>probe:Drosophila_2:1626319_a_at:700:285; Interrogation_Position=934; Antisense; CTGTGTGAGATTCTTGAGACGCAAC
>probe:Drosophila_2:1626319_a_at:150:425; Interrogation_Position=949; Antisense; GAGACGCAACGAATACAAAGCTCGT
>probe:Drosophila_2:1626319_a_at:16:209; Interrogation_Position=966; Antisense; AAGCTCGTTCAATGGGCAGCAGATC
>probe:Drosophila_2:1626319_a_at:492:263; Interrogation_Position=982; Antisense; CAGCAGATCGTAGGCAATGTTGGTC
>probe:Drosophila_2:1626319_a_at:105:231; Interrogation_Position=997; Antisense; AATGTTGGTCATTTGAAAGGGATCC

Paste this into a BLAST search page for me
AAAGGGATCCAGTTGCAGGTCATATCAGTTGCAGGTCATATGCCTCCAAAGGTCATATGCCTCCAAAAAGTTCTGGCTCAGCACTACTGAAACGGTTTCATATGAAATCTATATGCGCCCAGCGGGCGCCCAGCGGACTTGAATTTGGTTTTTGGCTAGGAGTAATATGCATATATATCTATACAAAACACGAGTGGCCCCGAGTGGCCCGAACACTGTGTGAGACTGTGTGAGATTCTTGAGACGCAACGAGACGCAACGAATACAAAGCTCGTAAGCTCGTTCAATGGGCAGCAGATCCAGCAGATCGTAGGCAATGTTGGTCAATGTTGGTCATTTGAAAGGGATCC

Full Affymetrix probeset data:

Annotations for 1626319_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime