FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626320_at:

>probe:Drosophila_2:1626320_at:450:173; Interrogation_Position=1020; Antisense; AAAGCTCCGCCTGGACATTGTGATG
>probe:Drosophila_2:1626320_at:309:223; Interrogation_Position=1048; Antisense; AAGGTATACGAACCAGCTCTGGCAA
>probe:Drosophila_2:1626320_at:448:707; Interrogation_Position=1087; Antisense; TTCAAACGAATGACCGAGGCCCTGA
>probe:Drosophila_2:1626320_at:417:129; Interrogation_Position=1135; Antisense; ACCATGCTGTCGGTGAATGCCAACA
>probe:Drosophila_2:1626320_at:495:49; Interrogation_Position=1151; Antisense; ATGCCAACATATTCTTTGCCAAGCG
>probe:Drosophila_2:1626320_at:9:435; Interrogation_Position=1226; Antisense; GAGTGGCGCAGGATCCCCAGCAGAA
>probe:Drosophila_2:1626320_at:219:463; Interrogation_Position=1283; Antisense; GATTCATAGTCAGCTACGGCCTGTT
>probe:Drosophila_2:1626320_at:366:23; Interrogation_Position=1317; Antisense; ATATCTGCACAGGTATGCCCTGGTG
>probe:Drosophila_2:1626320_at:512:623; Interrogation_Position=1332; Antisense; TGCCCTGGTGCGATGGTACTTGAAC
>probe:Drosophila_2:1626320_at:573:611; Interrogation_Position=1352; Antisense; TGAACTTCCGCGTCTGGCTGGTGGA
>probe:Drosophila_2:1626320_at:638:557; Interrogation_Position=1374; Antisense; GGACATATTCACCTATTACTTGCCC
>probe:Drosophila_2:1626320_at:173:313; Interrogation_Position=1395; Antisense; GCCCTACGTCGCCATTTGGAAGTTT
>probe:Drosophila_2:1626320_at:418:307; Interrogation_Position=1413; Antisense; GAAGTTTGGCCCGAAGTCCGCGTAT
>probe:Drosophila_2:1626320_at:252:693; Interrogation_Position=1474; Antisense; TTTGCCCTGGGCTTGAAGGACGATT

Paste this into a BLAST search page for me
AAAGCTCCGCCTGGACATTGTGATGAAGGTATACGAACCAGCTCTGGCAATTCAAACGAATGACCGAGGCCCTGAACCATGCTGTCGGTGAATGCCAACAATGCCAACATATTCTTTGCCAAGCGGAGTGGCGCAGGATCCCCAGCAGAAGATTCATAGTCAGCTACGGCCTGTTATATCTGCACAGGTATGCCCTGGTGTGCCCTGGTGCGATGGTACTTGAACTGAACTTCCGCGTCTGGCTGGTGGAGGACATATTCACCTATTACTTGCCCGCCCTACGTCGCCATTTGGAAGTTTGAAGTTTGGCCCGAAGTCCGCGTATTTTGCCCTGGGCTTGAAGGACGATT

Full Affymetrix probeset data:

Annotations for 1626320_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720