Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626325_a_at:

>probe:Drosophila_2:1626325_a_at:305:553; Interrogation_Position=160; Antisense; GGAGCAGGCCAGTCTAGTTCTATTC
>probe:Drosophila_2:1626325_a_at:570:83; Interrogation_Position=198; Antisense; AGTGCGGGTCTACCATCTAATCGGG
>probe:Drosophila_2:1626325_a_at:464:655; Interrogation_Position=215; Antisense; TAATCGGGCACCTAGGCATCGCAAC
>probe:Drosophila_2:1626325_a_at:28:405; Interrogation_Position=256; Antisense; GACTCACGGGTCATAATGCGCTCCA
>probe:Drosophila_2:1626325_a_at:82:617; Interrogation_Position=329; Antisense; TGCAGGCATCCCATCAGCGTAAGAT
>probe:Drosophila_2:1626325_a_at:433:99; Interrogation_Position=350; Antisense; AGATGTTTGAGCTCTGCGGTGTCGA
>probe:Drosophila_2:1626325_a_at:123:459; Interrogation_Position=373; Antisense; GATTTGCAGACCCAGGAGGCCTATG
>probe:Drosophila_2:1626325_a_at:671:291; Interrogation_Position=444; Antisense; CGTCGTCTACGGCATTAAGCTGATT
>probe:Drosophila_2:1626325_a_at:158:659; Interrogation_Position=459; Antisense; TAAGCTGATTCACTTCGATCGACCG
>probe:Drosophila_2:1626325_a_at:317:411; Interrogation_Position=516; Antisense; GACGCAGGAGTACTTAGCTACGCTA
>probe:Drosophila_2:1626325_a_at:579:137; Interrogation_Position=545; Antisense; ACGATATGGCTTTGGACCTCCGAAC
>probe:Drosophila_2:1626325_a_at:26:333; Interrogation_Position=600; Antisense; GCGGCATGCCCATTTTGATGTGACA
>probe:Drosophila_2:1626325_a_at:581:703; Interrogation_Position=662; Antisense; TTATCAAGAACCTCCGTCAACAACG
>probe:Drosophila_2:1626325_a_at:7:187; Interrogation_Position=680; Antisense; AACAACGTGACATCCTGAGGGCGCA

Paste this into a BLAST search page for me
GGAGCAGGCCAGTCTAGTTCTATTCAGTGCGGGTCTACCATCTAATCGGGTAATCGGGCACCTAGGCATCGCAACGACTCACGGGTCATAATGCGCTCCATGCAGGCATCCCATCAGCGTAAGATAGATGTTTGAGCTCTGCGGTGTCGAGATTTGCAGACCCAGGAGGCCTATGCGTCGTCTACGGCATTAAGCTGATTTAAGCTGATTCACTTCGATCGACCGGACGCAGGAGTACTTAGCTACGCTAACGATATGGCTTTGGACCTCCGAACGCGGCATGCCCATTTTGATGTGACATTATCAAGAACCTCCGTCAACAACGAACAACGTGACATCCTGAGGGCGCA

Full Affymetrix probeset data:

Annotations for 1626325_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime