FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626326_at:

>probe:Drosophila_2:1626326_at:506:245; Interrogation_Position=1000; Antisense; AATTATTACATCTCCGTTCTGCAGG
>probe:Drosophila_2:1626326_at:398:491; Interrogation_Position=1064; Antisense; GTCAATCGGGTCTTTGGAAGCGCCT
>probe:Drosophila_2:1626326_at:2:563; Interrogation_Position=1079; Antisense; GGAAGCGCCTGCATCAACACAAGTA
>probe:Drosophila_2:1626326_at:463:697; Interrogation_Position=1129; Antisense; TTTCTACCGCTGATGTGGGCATTGA
>probe:Drosophila_2:1626326_at:487:219; Interrogation_Position=1159; Antisense; AAGTCCGTTGACTTTGGCGATCTGC
>probe:Drosophila_2:1626326_at:596:373; Interrogation_Position=1237; Antisense; GAAGTCACCATATTGCTGGCTCGAC
>probe:Drosophila_2:1626326_at:326:287; Interrogation_Position=1252; Antisense; CTGGCTCGACTGGATCAATTGGGAT
>probe:Drosophila_2:1626326_at:642:407; Interrogation_Position=739; Antisense; GACGATTTCCTAGAGCGACTTGTTG
>probe:Drosophila_2:1626326_at:434:89; Interrogation_Position=803; Antisense; AGTACTGGGTACTTTGCCACGGAGA
>probe:Drosophila_2:1626326_at:526:103; Interrogation_Position=825; Antisense; AGACCTGCACCTTCGAAACATTATG
>probe:Drosophila_2:1626326_at:631:617; Interrogation_Position=883; Antisense; TGCATGCTGCTGGACTTTCAAATCA
>probe:Drosophila_2:1626326_at:65:239; Interrogation_Position=903; Antisense; AATCAGTAATCTCTTTCCCTTGACA
>probe:Drosophila_2:1626326_at:174:629; Interrogation_Position=918; Antisense; TCCCTTGACATTCGATCTACTCTAT
>probe:Drosophila_2:1626326_at:291:17; Interrogation_Position=946; Antisense; ATTTACATGCTTTTGGAGCCGGAGC

Paste this into a BLAST search page for me
AATTATTACATCTCCGTTCTGCAGGGTCAATCGGGTCTTTGGAAGCGCCTGGAAGCGCCTGCATCAACACAAGTATTTCTACCGCTGATGTGGGCATTGAAAGTCCGTTGACTTTGGCGATCTGCGAAGTCACCATATTGCTGGCTCGACCTGGCTCGACTGGATCAATTGGGATGACGATTTCCTAGAGCGACTTGTTGAGTACTGGGTACTTTGCCACGGAGAAGACCTGCACCTTCGAAACATTATGTGCATGCTGCTGGACTTTCAAATCAAATCAGTAATCTCTTTCCCTTGACATCCCTTGACATTCGATCTACTCTATATTTACATGCTTTTGGAGCCGGAGC

Full Affymetrix probeset data:

Annotations for 1626326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720