FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626328_at:

>probe:Drosophila_2:1626328_at:347:65; Interrogation_Position=298; Antisense; ATGGATTCCGATTCATCAGACGTGT
>probe:Drosophila_2:1626328_at:456:423; Interrogation_Position=349; Antisense; GAGAACGAGGAGTCCGACCCATCAT
>probe:Drosophila_2:1626328_at:673:35; Interrogation_Position=372; Antisense; ATCAGGTTCCTCACAGGATTCGATA
>probe:Drosophila_2:1626328_at:687:69; Interrogation_Position=425; Antisense; AGGCCAATCTAAGCGAGGACTCTGA
>probe:Drosophila_2:1626328_at:299:437; Interrogation_Position=439; Antisense; GAGGACTCTGACTCTTCATCGGGTT
>probe:Drosophila_2:1626328_at:227:713; Interrogation_Position=453; Antisense; TTCATCGGGTTCTTCAGAGCACTCT
>probe:Drosophila_2:1626328_at:509:649; Interrogation_Position=531; Antisense; TCAGCAGTCGGTTGTCAATGCAGTC
>probe:Drosophila_2:1626328_at:55:349; Interrogation_Position=550; Antisense; GCAGTCGGACTTTTGGTTAACATGA
>probe:Drosophila_2:1626328_at:412:685; Interrogation_Position=594; Antisense; TATCATGTCGAAAGTCGTCCCGCAA
>probe:Drosophila_2:1626328_at:702:361; Interrogation_Position=615; Antisense; GCAATCACCACTTGATCTTGTCGAC
>probe:Drosophila_2:1626328_at:400:597; Interrogation_Position=633; Antisense; TGTCGACCTCGTCCGCCAGAAAAAA
>probe:Drosophila_2:1626328_at:210:619; Interrogation_Position=668; Antisense; TGCGTCAACGCGATAAAGCCCAGTT
>probe:Drosophila_2:1626328_at:479:639; Interrogation_Position=827; Antisense; TCGTGCTGCAGATGCATTTGGCCAA
>probe:Drosophila_2:1626328_at:332:19; Interrogation_Position=842; Antisense; ATTTGGCCAAACTGCGACAGTCGGT

Paste this into a BLAST search page for me
ATGGATTCCGATTCATCAGACGTGTGAGAACGAGGAGTCCGACCCATCATATCAGGTTCCTCACAGGATTCGATAAGGCCAATCTAAGCGAGGACTCTGAGAGGACTCTGACTCTTCATCGGGTTTTCATCGGGTTCTTCAGAGCACTCTTCAGCAGTCGGTTGTCAATGCAGTCGCAGTCGGACTTTTGGTTAACATGATATCATGTCGAAAGTCGTCCCGCAAGCAATCACCACTTGATCTTGTCGACTGTCGACCTCGTCCGCCAGAAAAAATGCGTCAACGCGATAAAGCCCAGTTTCGTGCTGCAGATGCATTTGGCCAAATTTGGCCAAACTGCGACAGTCGGT

Full Affymetrix probeset data:

Annotations for 1626328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720