Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626329_at:

>probe:Drosophila_2:1626329_at:27:443; Interrogation_Position=199; Antisense; GATGTTCGGACCGTTCATGTGCAAC
>probe:Drosophila_2:1626329_at:472:509; Interrogation_Position=217; Antisense; GTGCAACGTGTACAACAGCCTGGAT
>probe:Drosophila_2:1626329_at:280:587; Interrogation_Position=237; Antisense; TGGATGTTTACTTTTCCACGGCCAG
>probe:Drosophila_2:1626329_at:306:7; Interrogation_Position=265; Antisense; ATTGCACCTGTGCTGCATATCAGTG
>probe:Drosophila_2:1626329_at:39:509; Interrogation_Position=308; Antisense; GTGCGTCCACTGGAGTATCCATTGA
>probe:Drosophila_2:1626329_at:70:159; Interrogation_Position=340; Antisense; ACACAAAACGGTCTGCTTCATGCTC
>probe:Drosophila_2:1626329_at:544:35; Interrogation_Position=407; Antisense; ATCTTTCTGGGCTGGTACACGACGG
>probe:Drosophila_2:1626329_at:413:129; Interrogation_Position=465; Antisense; ACCAGTGCTCGTTTGTGGTCAACAA
>probe:Drosophila_2:1626329_at:402:647; Interrogation_Position=501; Antisense; TCATCTCCAGTTCGGTGAGCTTCTG
>probe:Drosophila_2:1626329_at:254:117; Interrogation_Position=518; Antisense; AGCTTCTGGATACCCGGCATTGTGA
>probe:Drosophila_2:1626329_at:97:61; Interrogation_Position=551; Antisense; ATGTACTGGCGCATCTTTAAGGAGG
>probe:Drosophila_2:1626329_at:542:439; Interrogation_Position=572; Antisense; GAGGCGATTCGTCAACGCAAGGCCC
>probe:Drosophila_2:1626329_at:40:143; Interrogation_Position=687; Antisense; ACTGTGATCTGAATGCCACATCCGC
>probe:Drosophila_2:1626329_at:598:135; Interrogation_Position=722; Antisense; ACGCACAGTGCGCTTAGTAACTTGG

Paste this into a BLAST search page for me
GATGTTCGGACCGTTCATGTGCAACGTGCAACGTGTACAACAGCCTGGATTGGATGTTTACTTTTCCACGGCCAGATTGCACCTGTGCTGCATATCAGTGGTGCGTCCACTGGAGTATCCATTGAACACAAAACGGTCTGCTTCATGCTCATCTTTCTGGGCTGGTACACGACGGACCAGTGCTCGTTTGTGGTCAACAATCATCTCCAGTTCGGTGAGCTTCTGAGCTTCTGGATACCCGGCATTGTGAATGTACTGGCGCATCTTTAAGGAGGGAGGCGATTCGTCAACGCAAGGCCCACTGTGATCTGAATGCCACATCCGCACGCACAGTGCGCTTAGTAACTTGG

Full Affymetrix probeset data:

Annotations for 1626329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime