FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626331_at:

>probe:Drosophila_2:1626331_at:470:167; Interrogation_Position=101; Antisense; AAATGGCCGGACGTGAAGCCGTGAA
>probe:Drosophila_2:1626331_at:668:203; Interrogation_Position=116; Antisense; AAGCCGTGAAGCGAGCCGTACAGCA
>probe:Drosophila_2:1626331_at:377:659; Interrogation_Position=180; Antisense; TAAGCGTGCCCTCAATCTGTACAAG
>probe:Drosophila_2:1626331_at:401:489; Interrogation_Position=198; Antisense; GTACAAGGCCTGGTACCGCCAGATT
>probe:Drosophila_2:1626331_at:203:95; Interrogation_Position=218; Antisense; AGATTCCCTACATCGTCATGGACTA
>probe:Drosophila_2:1626331_at:297:429; Interrogation_Position=289; Antisense; GAGTTCGTCAAGCATCGCAATGTGA
>probe:Drosophila_2:1626331_at:300:401; Interrogation_Position=316; Antisense; GACATCCGGGTGATCGACATGCTGG
>probe:Drosophila_2:1626331_at:168:401; Interrogation_Position=331; Antisense; GACATGCTGGTCATCAAGGGCCAAA
>probe:Drosophila_2:1626331_at:496:537; Interrogation_Position=37; Antisense; GGTCACACTGTTCTGCTTGGAGCAA
>probe:Drosophila_2:1626331_at:717:109; Interrogation_Position=389; Antisense; AGAAGGGCCATATCATGCGCTACTG
>probe:Drosophila_2:1626331_at:169:403; Interrogation_Position=442; Antisense; GACTTCCTCTCAAAATTCATCCAGG
>probe:Drosophila_2:1626331_at:126:711; Interrogation_Position=457; Antisense; TTCATCCAGGGCGTTAATTAGTTAT
>probe:Drosophila_2:1626331_at:51:169; Interrogation_Position=532; Antisense; AAAGGGAGTTTTGTGCGCTTCAGAA
>probe:Drosophila_2:1626331_at:291:135; Interrogation_Position=557; Antisense; ACGCGTGTGTCCTTGTTTATTGAGA

Paste this into a BLAST search page for me
AAATGGCCGGACGTGAAGCCGTGAAAAGCCGTGAAGCGAGCCGTACAGCATAAGCGTGCCCTCAATCTGTACAAGGTACAAGGCCTGGTACCGCCAGATTAGATTCCCTACATCGTCATGGACTAGAGTTCGTCAAGCATCGCAATGTGAGACATCCGGGTGATCGACATGCTGGGACATGCTGGTCATCAAGGGCCAAAGGTCACACTGTTCTGCTTGGAGCAAAGAAGGGCCATATCATGCGCTACTGGACTTCCTCTCAAAATTCATCCAGGTTCATCCAGGGCGTTAATTAGTTATAAAGGGAGTTTTGTGCGCTTCAGAAACGCGTGTGTCCTTGTTTATTGAGA

Full Affymetrix probeset data:

Annotations for 1626331_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720