FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626334_at:

>probe:Drosophila_2:1626334_at:48:655; Interrogation_Position=283; Antisense; TCAATTTACCTAAGCCCGATCGCAT
>probe:Drosophila_2:1626334_at:32:717; Interrogation_Position=370; Antisense; TTCTGCAGCACGATTCTTGTCACAA
>probe:Drosophila_2:1626334_at:703:721; Interrogation_Position=386; Antisense; TTGTCACAACACTCCAGATTTCCAT
>probe:Drosophila_2:1626334_at:65:147; Interrogation_Position=412; Antisense; ACTCTGGTCAGAACTTGGCTTTGGT
>probe:Drosophila_2:1626334_at:138:31; Interrogation_Position=441; Antisense; ATAACCCTGCTACCTGAAGACGGAA
>probe:Drosophila_2:1626334_at:261:33; Interrogation_Position=466; Antisense; ATCACACCGACGAGTGCCTTGTTAA
>probe:Drosophila_2:1626334_at:633:101; Interrogation_Position=536; Antisense; AGAGCAATTGCAGCGTTTTCCCAAA
>probe:Drosophila_2:1626334_at:307:551; Interrogation_Position=570; Antisense; GGAGATTCCATTCGCAATTTTGCCG
>probe:Drosophila_2:1626334_at:269:443; Interrogation_Position=625; Antisense; GATGTGCCGCCTTGAGATTCGAGAA
>probe:Drosophila_2:1626334_at:544:341; Interrogation_Position=665; Antisense; GCTATTCCTTTTGGCCTGCAACTAT
>probe:Drosophila_2:1626334_at:135:683; Interrogation_Position=687; Antisense; TATGCCAGCAATTATGTTCCCGACT
>probe:Drosophila_2:1626334_at:128:203; Interrogation_Position=730; Antisense; AAGCCATTGGCTGTCAGTCCGGTTC
>probe:Drosophila_2:1626334_at:682:163; Interrogation_Position=762; Antisense; AAATATCCATCGCTTTGCAAGGCTG
>probe:Drosophila_2:1626334_at:408:27; Interrogation_Position=794; Antisense; ATACCAGGATCTTATCGGGCAGCAG

Paste this into a BLAST search page for me
TCAATTTACCTAAGCCCGATCGCATTTCTGCAGCACGATTCTTGTCACAATTGTCACAACACTCCAGATTTCCATACTCTGGTCAGAACTTGGCTTTGGTATAACCCTGCTACCTGAAGACGGAAATCACACCGACGAGTGCCTTGTTAAAGAGCAATTGCAGCGTTTTCCCAAAGGAGATTCCATTCGCAATTTTGCCGGATGTGCCGCCTTGAGATTCGAGAAGCTATTCCTTTTGGCCTGCAACTATTATGCCAGCAATTATGTTCCCGACTAAGCCATTGGCTGTCAGTCCGGTTCAAATATCCATCGCTTTGCAAGGCTGATACCAGGATCTTATCGGGCAGCAG

Full Affymetrix probeset data:

Annotations for 1626334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720