Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626336_at:

>probe:Drosophila_2:1626336_at:670:507; Interrogation_Position=2643; Antisense; GTGCGTGCCGATTGTCTGAGAACCA
>probe:Drosophila_2:1626336_at:96:381; Interrogation_Position=2662; Antisense; GAACCAACATGATTCACTAGTGCTC
>probe:Drosophila_2:1626336_at:311:147; Interrogation_Position=2677; Antisense; ACTAGTGCTCTATGACCACAACCTA
>probe:Drosophila_2:1626336_at:624:175; Interrogation_Position=2712; Antisense; AAACCGACGAGGCAAGCAAGCAACT
>probe:Drosophila_2:1626336_at:498:209; Interrogation_Position=2729; Antisense; AAGCAACTGGCAGCGTGCAACATGC
>probe:Drosophila_2:1626336_at:68:165; Interrogation_Position=2794; Antisense; AAATCGATTCGAAGCGGCGTAGTCA
>probe:Drosophila_2:1626336_at:317:121; Interrogation_Position=2806; Antisense; AGCGGCGTAGTCAGTCTTTCAAACA
>probe:Drosophila_2:1626336_at:308:239; Interrogation_Position=2830; Antisense; AATCTTAGCTCTATCTTTACTCAAG
>probe:Drosophila_2:1626336_at:430:481; Interrogation_Position=2854; Antisense; GTATTCTAGCGACATAAGCAACTGA
>probe:Drosophila_2:1626336_at:205:389; Interrogation_Position=2877; Antisense; GAAACTTTAACTCTAACTCTAGCTG
>probe:Drosophila_2:1626336_at:339:507; Interrogation_Position=3007; Antisense; GTGCTATTTAAACTCGTCTAAGACT
>probe:Drosophila_2:1626336_at:294:499; Interrogation_Position=3022; Antisense; GTCTAAGACTTCACTGCATAGCCTA
>probe:Drosophila_2:1626336_at:456:619; Interrogation_Position=3036; Antisense; TGCATAGCCTATGCCTAGAATCTAT
>probe:Drosophila_2:1626336_at:73:673; Interrogation_Position=3142; Antisense; TACCTTATACGATGTAGCCCTTGAA

Paste this into a BLAST search page for me
GTGCGTGCCGATTGTCTGAGAACCAGAACCAACATGATTCACTAGTGCTCACTAGTGCTCTATGACCACAACCTAAAACCGACGAGGCAAGCAAGCAACTAAGCAACTGGCAGCGTGCAACATGCAAATCGATTCGAAGCGGCGTAGTCAAGCGGCGTAGTCAGTCTTTCAAACAAATCTTAGCTCTATCTTTACTCAAGGTATTCTAGCGACATAAGCAACTGAGAAACTTTAACTCTAACTCTAGCTGGTGCTATTTAAACTCGTCTAAGACTGTCTAAGACTTCACTGCATAGCCTATGCATAGCCTATGCCTAGAATCTATTACCTTATACGATGTAGCCCTTGAA

Full Affymetrix probeset data:

Annotations for 1626336_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime