FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626337_at:

>probe:Drosophila_2:1626337_at:619:455; Interrogation_Position=310; Antisense; GATAACCAGTGACCAGCTGAGTTCA
>probe:Drosophila_2:1626337_at:471:607; Interrogation_Position=327; Antisense; TGAGTTCACTGCTTCGAGGAGCCTC
>probe:Drosophila_2:1626337_at:492:437; Interrogation_Position=342; Antisense; GAGGAGCCTCCAAAACCAACAGACA
>probe:Drosophila_2:1626337_at:228:505; Interrogation_Position=368; Antisense; GTCCTGTACGTGACGAACCTGAACT
>probe:Drosophila_2:1626337_at:396:587; Interrogation_Position=414; Antisense; TGGAGCTGCACTTCTCTGCGGCAGG
>probe:Drosophila_2:1626337_at:46:285; Interrogation_Position=429; Antisense; CTGCGGCAGGCACGGTCAAGTCTAT
>probe:Drosophila_2:1626337_at:404:219; Interrogation_Position=446; Antisense; AAGTCTATCCGCATTCCCAAGAAGC
>probe:Drosophila_2:1626337_at:593:583; Interrogation_Position=492; Antisense; TGGAAATGGCCGACCTAAGCAGTTT
>probe:Drosophila_2:1626337_at:41:209; Interrogation_Position=508; Antisense; AAGCAGTTTCCAGAATGCCTTCCAG
>probe:Drosophila_2:1626337_at:155:159; Interrogation_Position=540; Antisense; ACACAGAGCTGCAGGGACGCAACAT
>probe:Drosophila_2:1626337_at:578:107; Interrogation_Position=627; Antisense; AGAAGAACCGAAAGCTGGCCGAGAT
>probe:Drosophila_2:1626337_at:579:323; Interrogation_Position=652; Antisense; GCGCAACGAGCAGAAGACCTTCACG
>probe:Drosophila_2:1626337_at:605:411; Interrogation_Position=667; Antisense; GACCTTCACGAAGAGCGGCAAGTTT
>probe:Drosophila_2:1626337_at:243:285; Interrogation_Position=682; Antisense; CGGCAAGTTTTACGACAAGGACCTG

Paste this into a BLAST search page for me
GATAACCAGTGACCAGCTGAGTTCATGAGTTCACTGCTTCGAGGAGCCTCGAGGAGCCTCCAAAACCAACAGACAGTCCTGTACGTGACGAACCTGAACTTGGAGCTGCACTTCTCTGCGGCAGGCTGCGGCAGGCACGGTCAAGTCTATAAGTCTATCCGCATTCCCAAGAAGCTGGAAATGGCCGACCTAAGCAGTTTAAGCAGTTTCCAGAATGCCTTCCAGACACAGAGCTGCAGGGACGCAACATAGAAGAACCGAAAGCTGGCCGAGATGCGCAACGAGCAGAAGACCTTCACGGACCTTCACGAAGAGCGGCAAGTTTCGGCAAGTTTTACGACAAGGACCTG

Full Affymetrix probeset data:

Annotations for 1626337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720