Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626338_s_at:

>probe:Drosophila_2:1626338_s_at:281:551; Interrogation_Position=147; Antisense; GGAGCAAGTTAAACACCACCAGCAG
>probe:Drosophila_2:1626338_s_at:710:185; Interrogation_Position=182; Antisense; AACAGCAGGCATCCAGCATAGCAGC
>probe:Drosophila_2:1626338_s_at:192:61; Interrogation_Position=223; Antisense; ATGTACATGGATCCCATGCGCTACC
>probe:Drosophila_2:1626338_s_at:285:603; Interrogation_Position=317; Antisense; TGTTCCACACGAGCGATCAGTTGCA
>probe:Drosophila_2:1626338_s_at:569:417; Interrogation_Position=327; Antisense; GAGCGATCAGTTGCAGCACTCGCAG
>probe:Drosophila_2:1626338_s_at:714:113; Interrogation_Position=350; Antisense; AGCAGCAGACCGTCGGCGGCACCAG
>probe:Drosophila_2:1626338_s_at:728:107; Interrogation_Position=376; Antisense; AGCAACTCCCAATTGTCACCGGGTG
>probe:Drosophila_2:1626338_s_at:564:247; Interrogation_Position=386; Antisense; AATTGTCACCGGGTGCCGGCAGCAA
>probe:Drosophila_2:1626338_s_at:682:545; Interrogation_Position=454; Antisense; GGATCCGCATCCTCGGTGCTTGGTG
>probe:Drosophila_2:1626338_s_at:562:727; Interrogation_Position=473; Antisense; TTGGTGGCCATCTCAATCTGAATCC
>probe:Drosophila_2:1626338_s_at:129:39; Interrogation_Position=482; Antisense; ATCTCAATCTGAATCCGCTGCACCA
>probe:Drosophila_2:1626338_s_at:653:275; Interrogation_Position=588; Antisense; CTTCGAGTTGAGTCTGCAGTTTGGA
>probe:Drosophila_2:1626338_s_at:391:547; Interrogation_Position=628; Antisense; GGAGCGGTACGGCACTTTAACAGCT
>probe:Drosophila_2:1626338_s_at:591:139; Interrogation_Position=636; Antisense; ACGGCACTTTAACAGCTTTGGCGGG

Paste this into a BLAST search page for me
GGAGCAAGTTAAACACCACCAGCAGAACAGCAGGCATCCAGCATAGCAGCATGTACATGGATCCCATGCGCTACCTGTTCCACACGAGCGATCAGTTGCAGAGCGATCAGTTGCAGCACTCGCAGAGCAGCAGACCGTCGGCGGCACCAGAGCAACTCCCAATTGTCACCGGGTGAATTGTCACCGGGTGCCGGCAGCAAGGATCCGCATCCTCGGTGCTTGGTGTTGGTGGCCATCTCAATCTGAATCCATCTCAATCTGAATCCGCTGCACCACTTCGAGTTGAGTCTGCAGTTTGGAGGAGCGGTACGGCACTTTAACAGCTACGGCACTTTAACAGCTTTGGCGGG

Full Affymetrix probeset data:

Annotations for 1626338_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime