Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626340_at:

>probe:Drosophila_2:1626340_at:380:199; Interrogation_Position=2571; Antisense; AACCGCCCTGAACACGAATGTGGTG
>probe:Drosophila_2:1626340_at:254:519; Interrogation_Position=2590; Antisense; GTGGTGGTCCTCAATACCATTCACA
>probe:Drosophila_2:1626340_at:162:587; Interrogation_Position=2624; Antisense; TGGACTACATAATTCCGGCCAGCTG
>probe:Drosophila_2:1626340_at:399:557; Interrogation_Position=2652; Antisense; GGACACCGAGTTCCGTCAAATGTGG
>probe:Drosophila_2:1626340_at:321:259; Interrogation_Position=2731; Antisense; CACGAATATCTCAAGCACCTGCTGA
>probe:Drosophila_2:1626340_at:193:153; Interrogation_Position=2765; Antisense; ACATGAAGTGCCTCACGCCGGAGAA
>probe:Drosophila_2:1626340_at:647:57; Interrogation_Position=2827; Antisense; ATGTACGCCAAGTCCATTTTCGGAG
>probe:Drosophila_2:1626340_at:134:369; Interrogation_Position=2853; Antisense; GAATGCCTTGGCCAATCTGAGTATC
>probe:Drosophila_2:1626340_at:25:513; Interrogation_Position=2908; Antisense; GTGACGGGACACATACGCATTCGCG
>probe:Drosophila_2:1626340_at:372:345; Interrogation_Position=2924; Antisense; GCATTCGCGCCAAGAGTCAGGGCAT
>probe:Drosophila_2:1626340_at:135:349; Interrogation_Position=2945; Antisense; GCATGGCCTTGAGTCTGGGCGACAA
>probe:Drosophila_2:1626340_at:299:215; Interrogation_Position=2968; Antisense; AAGATCAGCTCCTCGCAGAAGCAGT
>probe:Drosophila_2:1626340_at:429:313; Interrogation_Position=3038; Antisense; GCCACCAGCAGGAGCGACGTATCTA
>probe:Drosophila_2:1626340_at:420:481; Interrogation_Position=3056; Antisense; GTATCTAGACGACGTACTCGGCCAC

Paste this into a BLAST search page for me
AACCGCCCTGAACACGAATGTGGTGGTGGTGGTCCTCAATACCATTCACATGGACTACATAATTCCGGCCAGCTGGGACACCGAGTTCCGTCAAATGTGGCACGAATATCTCAAGCACCTGCTGAACATGAAGTGCCTCACGCCGGAGAAATGTACGCCAAGTCCATTTTCGGAGGAATGCCTTGGCCAATCTGAGTATCGTGACGGGACACATACGCATTCGCGGCATTCGCGCCAAGAGTCAGGGCATGCATGGCCTTGAGTCTGGGCGACAAAAGATCAGCTCCTCGCAGAAGCAGTGCCACCAGCAGGAGCGACGTATCTAGTATCTAGACGACGTACTCGGCCAC

Full Affymetrix probeset data:

Annotations for 1626340_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime