Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626341_at:

>probe:Drosophila_2:1626341_at:237:711; Interrogation_Position=1574; Antisense; TTGTTGGCAAGAAGCTGGTCCTCAC
>probe:Drosophila_2:1626341_at:194:71; Interrogation_Position=1606; Antisense; AGGCCGCATCGTGCCAATGAATTGG
>probe:Drosophila_2:1626341_at:28:385; Interrogation_Position=1638; Antisense; GAACTACGGACCCATTTTCATCAAA
>probe:Drosophila_2:1626341_at:396:551; Interrogation_Position=1734; Antisense; GGAGAACTGGCCACTGCTCCAGAAA
>probe:Drosophila_2:1626341_at:163:221; Interrogation_Position=1769; Antisense; AAGTGCGATTCTGGTGCACCTCAGC
>probe:Drosophila_2:1626341_at:306:649; Interrogation_Position=1789; Antisense; TCAGCCAACTGCTCTAATTTGCTCA
>probe:Drosophila_2:1626341_at:565:241; Interrogation_Position=1804; Antisense; AATTTGCTCAAGTTCCCCAAGGATT
>probe:Drosophila_2:1626341_at:95:171; Interrogation_Position=1833; Antisense; AAAGGATGTGCGTTGTCCTCGCTGC
>probe:Drosophila_2:1626341_at:160:627; Interrogation_Position=1855; Antisense; TGCCGCAAGAACATCTCACTCAAGG
>probe:Drosophila_2:1626341_at:700:299; Interrogation_Position=1952; Antisense; CCGTGGAGGCCATAGAACTTTTCAA
>probe:Drosophila_2:1626341_at:602:431; Interrogation_Position=1978; Antisense; GAGTCGCTCGATATGTTCTTCCAAG
>probe:Drosophila_2:1626341_at:35:75; Interrogation_Position=2021; Antisense; AGGACACCATAGTGGCGCAGCAGTC
>probe:Drosophila_2:1626341_at:605:349; Interrogation_Position=2040; Antisense; GCAGTCGCTGCATAAGTGTTTGTCC
>probe:Drosophila_2:1626341_at:717:487; Interrogation_Position=2055; Antisense; GTGTTTGTCCGATACGGGAACCACA

Paste this into a BLAST search page for me
TTGTTGGCAAGAAGCTGGTCCTCACAGGCCGCATCGTGCCAATGAATTGGGAACTACGGACCCATTTTCATCAAAGGAGAACTGGCCACTGCTCCAGAAAAAGTGCGATTCTGGTGCACCTCAGCTCAGCCAACTGCTCTAATTTGCTCAAATTTGCTCAAGTTCCCCAAGGATTAAAGGATGTGCGTTGTCCTCGCTGCTGCCGCAAGAACATCTCACTCAAGGCCGTGGAGGCCATAGAACTTTTCAAGAGTCGCTCGATATGTTCTTCCAAGAGGACACCATAGTGGCGCAGCAGTCGCAGTCGCTGCATAAGTGTTTGTCCGTGTTTGTCCGATACGGGAACCACA

Full Affymetrix probeset data:

Annotations for 1626341_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime