Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626342_at:

>probe:Drosophila_2:1626342_at:450:95; Interrogation_Position=278; Antisense; AGATCATTCTGCTGACGGAGCGCCA
>probe:Drosophila_2:1626342_at:714:553; Interrogation_Position=294; Antisense; GGAGCGCCAGCTGCTAAAGATCTTC
>probe:Drosophila_2:1626342_at:218:171; Interrogation_Position=309; Antisense; AAAGATCTTCCTGTGGCCAATTAAG
>probe:Drosophila_2:1626342_at:433:575; Interrogation_Position=382; Antisense; GGCGAGTGTGCCATCAATGTGACCA
>probe:Drosophila_2:1626342_at:216:229; Interrogation_Position=397; Antisense; AATGTGACCAGCAGTTCGGCCGATT
>probe:Drosophila_2:1626342_at:705:157; Interrogation_Position=436; Antisense; ACACTAGACTTTCTGGGCTGCGCAC
>probe:Drosophila_2:1626342_at:599:495; Interrogation_Position=472; Antisense; GTCACGTCGATCAATCTGGTGCTGG
>probe:Drosophila_2:1626342_at:715:411; Interrogation_Position=522; Antisense; GACCCTCGATGGCTATCAGCTGTAT
>probe:Drosophila_2:1626342_at:264:217; Interrogation_Position=610; Antisense; AAGTTTACCACCAAGGGCATCCTGT
>probe:Drosophila_2:1626342_at:309:347; Interrogation_Position=626; Antisense; GCATCCTGTACGTTGCCAATGGACA
>probe:Drosophila_2:1626342_at:342:251; Interrogation_Position=642; Antisense; CAATGGACAGGCCTCGTTGCGATAC
>probe:Drosophila_2:1626342_at:367:219; Interrogation_Position=727; Antisense; AAGTCCACCGAGAATGCCATCCAAG
>probe:Drosophila_2:1626342_at:487:223; Interrogation_Position=749; Antisense; AAGGATTTGACGACCTGAACGCCGC
>probe:Drosophila_2:1626342_at:371:313; Interrogation_Position=772; Antisense; GCCATCGATGCCTGTGCTGCAAATT

Paste this into a BLAST search page for me
AGATCATTCTGCTGACGGAGCGCCAGGAGCGCCAGCTGCTAAAGATCTTCAAAGATCTTCCTGTGGCCAATTAAGGGCGAGTGTGCCATCAATGTGACCAAATGTGACCAGCAGTTCGGCCGATTACACTAGACTTTCTGGGCTGCGCACGTCACGTCGATCAATCTGGTGCTGGGACCCTCGATGGCTATCAGCTGTATAAGTTTACCACCAAGGGCATCCTGTGCATCCTGTACGTTGCCAATGGACACAATGGACAGGCCTCGTTGCGATACAAGTCCACCGAGAATGCCATCCAAGAAGGATTTGACGACCTGAACGCCGCGCCATCGATGCCTGTGCTGCAAATT

Full Affymetrix probeset data:

Annotations for 1626342_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime