Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626343_at:

>probe:Drosophila_2:1626343_at:286:67; Interrogation_Position=269; Antisense; ATGGCGAGTACACGAGGACCCCGAA
>probe:Drosophila_2:1626343_at:591:369; Interrogation_Position=291; Antisense; GAATGGAAGCCACCTCACGGAACTG
>probe:Drosophila_2:1626343_at:632:559; Interrogation_Position=354; Antisense; GGAAATGGGCTTGTCCTGGGACCAC
>probe:Drosophila_2:1626343_at:435:593; Interrogation_Position=370; Antisense; TGGGACCACGTGGTGGCCTCTACAA
>probe:Drosophila_2:1626343_at:532:665; Interrogation_Position=390; Antisense; TACAATGCCGCGTGCCGAGGAGACG
>probe:Drosophila_2:1626343_at:279:425; Interrogation_Position=409; Antisense; GAGACGGCCATGATCATCCTGAAGC
>probe:Drosophila_2:1626343_at:689:45; Interrogation_Position=424; Antisense; ATCCTGAAGCAGCTGAACCTCGATC
>probe:Drosophila_2:1626343_at:196:203; Interrogation_Position=439; Antisense; AACCTCGATCCCCTGAAGATGAAGC
>probe:Drosophila_2:1626343_at:451:99; Interrogation_Position=455; Antisense; AGATGAAGCGCTGCACTTTGCTGCC
>probe:Drosophila_2:1626343_at:502:305; Interrogation_Position=531; Antisense; CCTGGACCTGGCCTATCAGAGGGAT
>probe:Drosophila_2:1626343_at:137:645; Interrogation_Position=590; Antisense; TCTTCAGGGCCAGTCCGGAGCAGGA
>probe:Drosophila_2:1626343_at:714:229; Interrogation_Position=649; Antisense; AATGTGATCCGTTACCTGATTCTGC
>probe:Drosophila_2:1626343_at:337:35; Interrogation_Position=730; Antisense; ATCACCTGGCTGACTGTGTGGCCGT
>probe:Drosophila_2:1626343_at:588:511; Interrogation_Position=802; Antisense; GTGACCGAGATCACCCATCGAAGGC

Paste this into a BLAST search page for me
ATGGCGAGTACACGAGGACCCCGAAGAATGGAAGCCACCTCACGGAACTGGGAAATGGGCTTGTCCTGGGACCACTGGGACCACGTGGTGGCCTCTACAATACAATGCCGCGTGCCGAGGAGACGGAGACGGCCATGATCATCCTGAAGCATCCTGAAGCAGCTGAACCTCGATCAACCTCGATCCCCTGAAGATGAAGCAGATGAAGCGCTGCACTTTGCTGCCCCTGGACCTGGCCTATCAGAGGGATTCTTCAGGGCCAGTCCGGAGCAGGAAATGTGATCCGTTACCTGATTCTGCATCACCTGGCTGACTGTGTGGCCGTGTGACCGAGATCACCCATCGAAGGC

Full Affymetrix probeset data:

Annotations for 1626343_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime