FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626344_at:

>probe:Drosophila_2:1626344_at:65:673; Interrogation_Position=1007; Antisense; TACCGCGCTTTGCACATAACTCTGT
>probe:Drosophila_2:1626344_at:153:147; Interrogation_Position=1025; Antisense; ACTCTGTGTCTGTTTCTGAATGCTG
>probe:Drosophila_2:1626344_at:309:615; Interrogation_Position=1041; Antisense; TGAATGCTGACCAGGTTGCGCCGAA
>probe:Drosophila_2:1626344_at:652:539; Interrogation_Position=1054; Antisense; GGTTGCGCCGAAACAAGATCTCTAC
>probe:Drosophila_2:1626344_at:485:193; Interrogation_Position=1107; Antisense; AACTGACTTCGTTGGCCCGGGACAT
>probe:Drosophila_2:1626344_at:586:527; Interrogation_Position=1125; Antisense; GGGACATATCCAGCGAGTTGACAAA
>probe:Drosophila_2:1626344_at:260:177; Interrogation_Position=1197; Antisense; AAACGGCGCCGAAGTACTTGTTCAT
>probe:Drosophila_2:1626344_at:36:619; Interrogation_Position=1236; Antisense; TGCAGCACCACACGAACTTTCAGAG
>probe:Drosophila_2:1626344_at:658:625; Interrogation_Position=1278; Antisense; TGCCCCGCAATGTGCTTAGTATCAT
>probe:Drosophila_2:1626344_at:295:275; Interrogation_Position=1292; Antisense; CTTAGTATCATTGCGGACTTGGCCA
>probe:Drosophila_2:1626344_at:4:229; Interrogation_Position=1336; Antisense; AATGGAGAGTGCTCCTGCCGAGGAA
>probe:Drosophila_2:1626344_at:287:267; Interrogation_Position=1418; Antisense; CAGTACTATGTGATCCTGTGCAATA
>probe:Drosophila_2:1626344_at:726:721; Interrogation_Position=1454; Antisense; TTGCTGGACGTCACCCAGGAAGCGA
>probe:Drosophila_2:1626344_at:374:379; Interrogation_Position=1472; Antisense; GAAGCGAGGCGCATTTTCGAGCAAG

Paste this into a BLAST search page for me
TACCGCGCTTTGCACATAACTCTGTACTCTGTGTCTGTTTCTGAATGCTGTGAATGCTGACCAGGTTGCGCCGAAGGTTGCGCCGAAACAAGATCTCTACAACTGACTTCGTTGGCCCGGGACATGGGACATATCCAGCGAGTTGACAAAAAACGGCGCCGAAGTACTTGTTCATTGCAGCACCACACGAACTTTCAGAGTGCCCCGCAATGTGCTTAGTATCATCTTAGTATCATTGCGGACTTGGCCAAATGGAGAGTGCTCCTGCCGAGGAACAGTACTATGTGATCCTGTGCAATATTGCTGGACGTCACCCAGGAAGCGAGAAGCGAGGCGCATTTTCGAGCAAG

Full Affymetrix probeset data:

Annotations for 1626344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720