FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626345_at:

>probe:Drosophila_2:1626345_at:698:713; Interrogation_Position=102; Antisense; TTCTCTTGGCCATGTTCGCTGCCCT
>probe:Drosophila_2:1626345_at:513:345; Interrogation_Position=13; Antisense; GCATCAGTAACTCAGCATCAGTACT
>probe:Drosophila_2:1626345_at:470:103; Interrogation_Position=171; Antisense; AGACCGACAACACCCAGTACATTCG
>probe:Drosophila_2:1626345_at:192:489; Interrogation_Position=187; Antisense; GTACATTCGTACTGGTTAGGATTAG
>probe:Drosophila_2:1626345_at:99:493; Interrogation_Position=19; Antisense; GTAACTCAGCATCAGTACTACCAAG
>probe:Drosophila_2:1626345_at:261:543; Interrogation_Position=205; Antisense; GGATTAGAGAACCATGTTGACCCAA
>probe:Drosophila_2:1626345_at:491:467; Interrogation_Position=220; Antisense; GTTGACCCAACATTTGACATTTGCC
>probe:Drosophila_2:1626345_at:404:611; Interrogation_Position=234; Antisense; TGACATTTGCCTATCCATTTGGACT
>probe:Drosophila_2:1626345_at:306:277; Interrogation_Position=244; Antisense; CTATCCATTTGGACTTTTGAATAAA
>probe:Drosophila_2:1626345_at:331:645; Interrogation_Position=30; Antisense; TCAGTACTACCAAGCCAACCAACAA
>probe:Drosophila_2:1626345_at:477:181; Interrogation_Position=376; Antisense; AAAAGTCACTTCAAAGTCAGTGCAA
>probe:Drosophila_2:1626345_at:390:215; Interrogation_Position=389; Antisense; AAGTCAGTGCAAATTTCGTCATTAA
>probe:Drosophila_2:1626345_at:479:185; Interrogation_Position=50; Antisense; AACAACCACCAAACCTCAGAAATCA
>probe:Drosophila_2:1626345_at:718:189; Interrogation_Position=74; Antisense; AACATGAAGTTCTTCCAAGCCGCCG

Paste this into a BLAST search page for me
TTCTCTTGGCCATGTTCGCTGCCCTGCATCAGTAACTCAGCATCAGTACTAGACCGACAACACCCAGTACATTCGGTACATTCGTACTGGTTAGGATTAGGTAACTCAGCATCAGTACTACCAAGGGATTAGAGAACCATGTTGACCCAAGTTGACCCAACATTTGACATTTGCCTGACATTTGCCTATCCATTTGGACTCTATCCATTTGGACTTTTGAATAAATCAGTACTACCAAGCCAACCAACAAAAAAGTCACTTCAAAGTCAGTGCAAAAGTCAGTGCAAATTTCGTCATTAAAACAACCACCAAACCTCAGAAATCAAACATGAAGTTCTTCCAAGCCGCCG

Full Affymetrix probeset data:

Annotations for 1626345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720