FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626347_at:

>probe:Drosophila_2:1626347_at:381:579; Interrogation_Position=255; Antisense; GGCCACCAGTGGAAGCGATGAAAGT
>probe:Drosophila_2:1626347_at:37:393; Interrogation_Position=274; Antisense; GAAAGTCTTCCTCAGAAGCCTCAGA
>probe:Drosophila_2:1626347_at:335:5; Interrogation_Position=309; Antisense; AGTCCAGGATGCCAACGAAACCAAA
>probe:Drosophila_2:1626347_at:294:117; Interrogation_Position=423; Antisense; AGCTCGTCCGGAGAACGCTTATGCA
>probe:Drosophila_2:1626347_at:139:683; Interrogation_Position=442; Antisense; TATGCAGTGGTTACAGTGCGCCAAA
>probe:Drosophila_2:1626347_at:288:495; Interrogation_Position=509; Antisense; GTCAGAGCTCCAACAAAGATGCCAA
>probe:Drosophila_2:1626347_at:625:45; Interrogation_Position=567; Antisense; ATCCCGCCAGGATTGGAAGTTCAAC
>probe:Drosophila_2:1626347_at:350:95; Interrogation_Position=602; Antisense; AGATTTCCATACAACAAACCGCCTT
>probe:Drosophila_2:1626347_at:125:177; Interrogation_Position=617; Antisense; AAACCGCCTTTGATGTGGAGAAACT
>probe:Drosophila_2:1626347_at:605:195; Interrogation_Position=638; Antisense; AACTGGATGACGAGCTGTGGCCAAC
>probe:Drosophila_2:1626347_at:367:595; Interrogation_Position=653; Antisense; TGTGGCCAACTGCTCTGGAGTATTT
>probe:Drosophila_2:1626347_at:378:353; Interrogation_Position=694; Antisense; GCAGCGCGCTCAAAGATCAGTCAGT
>probe:Drosophila_2:1626347_at:184:393; Interrogation_Position=785; Antisense; GAAAGCTAATCGAGTCCACGCAGTA
>probe:Drosophila_2:1626347_at:150:293; Interrogation_Position=822; Antisense; CGATCTCCTCCAAAGCTTCGACTAG

Paste this into a BLAST search page for me
GGCCACCAGTGGAAGCGATGAAAGTGAAAGTCTTCCTCAGAAGCCTCAGAAGTCCAGGATGCCAACGAAACCAAAAGCTCGTCCGGAGAACGCTTATGCATATGCAGTGGTTACAGTGCGCCAAAGTCAGAGCTCCAACAAAGATGCCAAATCCCGCCAGGATTGGAAGTTCAACAGATTTCCATACAACAAACCGCCTTAAACCGCCTTTGATGTGGAGAAACTAACTGGATGACGAGCTGTGGCCAACTGTGGCCAACTGCTCTGGAGTATTTGCAGCGCGCTCAAAGATCAGTCAGTGAAAGCTAATCGAGTCCACGCAGTACGATCTCCTCCAAAGCTTCGACTAG

Full Affymetrix probeset data:

Annotations for 1626347_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720