FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626349_at:

>probe:Drosophila_2:1626349_at:602:497; Interrogation_Position=7005; Antisense; GTCTATGCGCATGCAGCACAACTTA
>probe:Drosophila_2:1626349_at:240:551; Interrogation_Position=7083; Antisense; GGAGTTCTCGATGATGTTCAAGCAC
>probe:Drosophila_2:1626349_at:414:111; Interrogation_Position=7221; Antisense; AGCAATTCTCGATGTTGTCGACCCC
>probe:Drosophila_2:1626349_at:477:67; Interrogation_Position=7253; Antisense; ATGGCTACGTCTCTCTGCAGGAATA
>probe:Drosophila_2:1626349_at:414:241; Interrogation_Position=7274; Antisense; AATACATCGCGTTCATGATCTCCAA
>probe:Drosophila_2:1626349_at:146:77; Interrogation_Position=7325; Antisense; AGGAGATCGAGAATGCCTTCCGCGC
>probe:Drosophila_2:1626349_at:345:293; Interrogation_Position=7362; Antisense; CGACCGCCCCTATGTAACTAAGGAG
>probe:Drosophila_2:1626349_at:453:223; Interrogation_Position=7381; Antisense; AAGGAGGAGCTCTACTGCAACCTCA
>probe:Drosophila_2:1626349_at:638:73; Interrogation_Position=7409; Antisense; AGGACATGGCTGACTACTGCGTGCA
>probe:Drosophila_2:1626349_at:564:353; Interrogation_Position=7431; Antisense; GCAGCGCATGAAACCCTTCTCGGAA
>probe:Drosophila_2:1626349_at:494:77; Interrogation_Position=7478; Antisense; AGGATGCCCTGGACTACATAGACTT
>probe:Drosophila_2:1626349_at:680:149; Interrogation_Position=7493; Antisense; ACATAGACTTCACGCGAACGCTGTT
>probe:Drosophila_2:1626349_at:650:343; Interrogation_Position=7535; Antisense; GCATTGTCTTATTTAGTGGCGCCTG
>probe:Drosophila_2:1626349_at:404:577; Interrogation_Position=7552; Antisense; GGCGCCTGAGCATATGTCTTACAAT

Paste this into a BLAST search page for me
GTCTATGCGCATGCAGCACAACTTAGGAGTTCTCGATGATGTTCAAGCACAGCAATTCTCGATGTTGTCGACCCCATGGCTACGTCTCTCTGCAGGAATAAATACATCGCGTTCATGATCTCCAAAGGAGATCGAGAATGCCTTCCGCGCCGACCGCCCCTATGTAACTAAGGAGAAGGAGGAGCTCTACTGCAACCTCAAGGACATGGCTGACTACTGCGTGCAGCAGCGCATGAAACCCTTCTCGGAAAGGATGCCCTGGACTACATAGACTTACATAGACTTCACGCGAACGCTGTTGCATTGTCTTATTTAGTGGCGCCTGGGCGCCTGAGCATATGTCTTACAAT

Full Affymetrix probeset data:

Annotations for 1626349_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720