Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626350_at:

>probe:Drosophila_2:1626350_at:76:417; Interrogation_Position=1068; Antisense; GAGCGATCTCGGTCTTAACCTAGAT
>probe:Drosophila_2:1626350_at:557:201; Interrogation_Position=1084; Antisense; AACCTAGATCCCAAACTGCGTGAGA
>probe:Drosophila_2:1626350_at:405:423; Interrogation_Position=1105; Antisense; GAGAACTACGGCTTGCAACTGAAGA
>probe:Drosophila_2:1626350_at:193:445; Interrogation_Position=1170; Antisense; GATGAAGTTTCTCGAGCTATGCTCA
>probe:Drosophila_2:1626350_at:595:23; Interrogation_Position=1194; Antisense; ATATCGAGAGTTCTGGCACCCTATA
>probe:Drosophila_2:1626350_at:691:663; Interrogation_Position=1219; Antisense; TACAGGGCAGCTTTGAACCGTGTCC
>probe:Drosophila_2:1626350_at:671:259; Interrogation_Position=1256; Antisense; CACCCACGTATCTGTATCGATTCGA
>probe:Drosophila_2:1626350_at:369:255; Interrogation_Position=1290; Antisense; CAAACTGTGCAACGCCATTAGGATT
>probe:Drosophila_2:1626350_at:219:79; Interrogation_Position=1309; Antisense; AGGATTGTACTTTGCGGCCATCAGA
>probe:Drosophila_2:1626350_at:530:533; Interrogation_Position=1351; Antisense; GGTGACGATCTGTGCTATATTTTCC
>probe:Drosophila_2:1626350_at:318:695; Interrogation_Position=1371; Antisense; TTTCCACAGCATGTTGTCGCATCAA
>probe:Drosophila_2:1626350_at:677:727; Interrogation_Position=1446; Antisense; TTGGACGAGTTTCGCAGCCCACGGA
>probe:Drosophila_2:1626350_at:256:219; Interrogation_Position=1562; Antisense; AAGTCATGGCGCTTCCAGAATTGCA
>probe:Drosophila_2:1626350_at:698:593; Interrogation_Position=1601; Antisense; TGTGGAATAGTTTCTACGCCCCAAA

Paste this into a BLAST search page for me
GAGCGATCTCGGTCTTAACCTAGATAACCTAGATCCCAAACTGCGTGAGAGAGAACTACGGCTTGCAACTGAAGAGATGAAGTTTCTCGAGCTATGCTCAATATCGAGAGTTCTGGCACCCTATATACAGGGCAGCTTTGAACCGTGTCCCACCCACGTATCTGTATCGATTCGACAAACTGTGCAACGCCATTAGGATTAGGATTGTACTTTGCGGCCATCAGAGGTGACGATCTGTGCTATATTTTCCTTTCCACAGCATGTTGTCGCATCAATTGGACGAGTTTCGCAGCCCACGGAAAGTCATGGCGCTTCCAGAATTGCATGTGGAATAGTTTCTACGCCCCAAA

Full Affymetrix probeset data:

Annotations for 1626350_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime