FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626351_at:

>probe:Drosophila_2:1626351_at:364:419; Interrogation_Position=382; Antisense; GAGCTCATGCACCAGTACGAGGCCT
>probe:Drosophila_2:1626351_at:379:571; Interrogation_Position=421; Antisense; GGCTACAATGGTGCCGACGATTACA
>probe:Drosophila_2:1626351_at:521:461; Interrogation_Position=439; Antisense; GATTACAAGCGCCTGCATCTGCTGG
>probe:Drosophila_2:1626351_at:684:35; Interrogation_Position=479; Antisense; ATCAGGCCGCTGTTAATGACACCGC
>probe:Drosophila_2:1626351_at:338:207; Interrogation_Position=519; Antisense; AAGCGGCTGCCTCGAGACGTTGAAC
>probe:Drosophila_2:1626351_at:347:537; Interrogation_Position=554; Antisense; GGTACATCCAGCACCGCGATAAGCT
>probe:Drosophila_2:1626351_at:55:33; Interrogation_Position=572; Antisense; ATAAGCTCTACATGTGGGCCATCGT
>probe:Drosophila_2:1626351_at:613:465; Interrogation_Position=595; Antisense; GTTGGCCTTGAGATCTTCATACTGC
>probe:Drosophila_2:1626351_at:504:29; Interrogation_Position=613; Antisense; ATACTGCTGCAAACTGTGGCGCTGA
>probe:Drosophila_2:1626351_at:521:607; Interrogation_Position=635; Antisense; TGAGTGTGCTGCTCTTTCGACTACG
>probe:Drosophila_2:1626351_at:131:719; Interrogation_Position=650; Antisense; TTCGACTACGACAGCGGCAGCGCAT
>probe:Drosophila_2:1626351_at:389:411; Interrogation_Position=757; Antisense; GACGCCTGAGCTACCATTAAGATCT
>probe:Drosophila_2:1626351_at:416:431; Interrogation_Position=863; Antisense; GAGTCTTGTTGGTCAGCTGGCAGCA
>probe:Drosophila_2:1626351_at:298:457; Interrogation_Position=894; Antisense; GATACCCAAGATGATGCCTACGACC

Paste this into a BLAST search page for me
GAGCTCATGCACCAGTACGAGGCCTGGCTACAATGGTGCCGACGATTACAGATTACAAGCGCCTGCATCTGCTGGATCAGGCCGCTGTTAATGACACCGCAAGCGGCTGCCTCGAGACGTTGAACGGTACATCCAGCACCGCGATAAGCTATAAGCTCTACATGTGGGCCATCGTGTTGGCCTTGAGATCTTCATACTGCATACTGCTGCAAACTGTGGCGCTGATGAGTGTGCTGCTCTTTCGACTACGTTCGACTACGACAGCGGCAGCGCATGACGCCTGAGCTACCATTAAGATCTGAGTCTTGTTGGTCAGCTGGCAGCAGATACCCAAGATGATGCCTACGACC

Full Affymetrix probeset data:

Annotations for 1626351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720