FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626352_at:

>probe:Drosophila_2:1626352_at:89:701; Interrogation_Position=1013; Antisense; TTTTCTATGCCCCAAGCTCTGTTCA
>probe:Drosophila_2:1626352_at:730:643; Interrogation_Position=1045; Antisense; TCTTGCTATGCATGTACACGTGTAT
>probe:Drosophila_2:1626352_at:249:553; Interrogation_Position=1079; Antisense; GGAGCAGCTTCTGTTCTGCCAAATA
>probe:Drosophila_2:1626352_at:197:73; Interrogation_Position=1130; Antisense; AGGCAACAGAGCTTGGACACGCGCT
>probe:Drosophila_2:1626352_at:186:635; Interrogation_Position=1178; Antisense; TCGCCTTACTCAAAGTGCCGTTTTT
>probe:Drosophila_2:1626352_at:182:507; Interrogation_Position=1192; Antisense; GTGCCGTTTTTTCGTGTATTTGTAG
>probe:Drosophila_2:1626352_at:517:245; Interrogation_Position=695; Antisense; AATTACTATACAGCCACTGCATGTG
>probe:Drosophila_2:1626352_at:671:627; Interrogation_Position=782; Antisense; TGCCAGCCGCTGTGTATGTGCAAAG
>probe:Drosophila_2:1626352_at:60:359; Interrogation_Position=801; Antisense; GCAAAGCTTTTTTATGTTTCGCACA
>probe:Drosophila_2:1626352_at:222:243; Interrogation_Position=887; Antisense; AATTTCCGCGCGTGTGCAAGGTGAA
>probe:Drosophila_2:1626352_at:229:615; Interrogation_Position=901; Antisense; TGCAAGGTGAAGTCGCGTCGCGTCA
>probe:Drosophila_2:1626352_at:615:647; Interrogation_Position=923; Antisense; TCAGTCCGTCGGTCGTATAGTCTCT
>probe:Drosophila_2:1626352_at:199:483; Interrogation_Position=937; Antisense; GTATAGTCTCTCTTCGTGTCCACTT
>probe:Drosophila_2:1626352_at:19:723; Interrogation_Position=972; Antisense; TTGCCGTATCTCTGTCGTGCAACAA

Paste this into a BLAST search page for me
TTTTCTATGCCCCAAGCTCTGTTCATCTTGCTATGCATGTACACGTGTATGGAGCAGCTTCTGTTCTGCCAAATAAGGCAACAGAGCTTGGACACGCGCTTCGCCTTACTCAAAGTGCCGTTTTTGTGCCGTTTTTTCGTGTATTTGTAGAATTACTATACAGCCACTGCATGTGTGCCAGCCGCTGTGTATGTGCAAAGGCAAAGCTTTTTTATGTTTCGCACAAATTTCCGCGCGTGTGCAAGGTGAATGCAAGGTGAAGTCGCGTCGCGTCATCAGTCCGTCGGTCGTATAGTCTCTGTATAGTCTCTCTTCGTGTCCACTTTTGCCGTATCTCTGTCGTGCAACAA

Full Affymetrix probeset data:

Annotations for 1626352_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720