FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626353_at:

>probe:Drosophila_2:1626353_at:378:139; Interrogation_Position=1009; Antisense; ACGTTTATTCTGGAAGTCGCTGCTT
>probe:Drosophila_2:1626353_at:73:503; Interrogation_Position=1024; Antisense; GTCGCTGCTTAATCGGTTCTGATAG
>probe:Drosophila_2:1626353_at:32:323; Interrogation_Position=529; Antisense; GCCCACGCATGCATTTGAGTCGATA
>probe:Drosophila_2:1626353_at:209:429; Interrogation_Position=566; Antisense; GAGTACACGGAACAGACCTTCTCTT
>probe:Drosophila_2:1626353_at:556:275; Interrogation_Position=588; Antisense; CTTCGCTATTGCTCCTGCTGTTGGA
>probe:Drosophila_2:1626353_at:602:607; Interrogation_Position=628; Antisense; TGACCTAAATGCTGATCATGCCGCC
>probe:Drosophila_2:1626353_at:667:449; Interrogation_Position=693; Antisense; GATCGATACCGCTGGCAGGACGTCA
>probe:Drosophila_2:1626353_at:662:9; Interrogation_Position=731; Antisense; ATTCCGCTCGAGGTGCTGGTGCTGC
>probe:Drosophila_2:1626353_at:294:69; Interrogation_Position=756; Antisense; ATGGCGTCAGCCAGGAGCGCATCAT
>probe:Drosophila_2:1626353_at:435:601; Interrogation_Position=815; Antisense; TGTATATTCGATGTGGCCAGTGCCG
>probe:Drosophila_2:1626353_at:615:241; Interrogation_Position=842; Antisense; AATACGCACCTAAAGCTCGCCAGGC
>probe:Drosophila_2:1626353_at:507:545; Interrogation_Position=925; Antisense; GGATGCATATTTGGAGCGCCTCCGC
>probe:Drosophila_2:1626353_at:509:659; Interrogation_Position=966; Antisense; TAACCCACAAGAGCTGCGTAGGCCG
>probe:Drosophila_2:1626353_at:110:157; Interrogation_Position=993; Antisense; ACACCTTACTGCCAGCACGTTTATT

Paste this into a BLAST search page for me
ACGTTTATTCTGGAAGTCGCTGCTTGTCGCTGCTTAATCGGTTCTGATAGGCCCACGCATGCATTTGAGTCGATAGAGTACACGGAACAGACCTTCTCTTCTTCGCTATTGCTCCTGCTGTTGGATGACCTAAATGCTGATCATGCCGCCGATCGATACCGCTGGCAGGACGTCAATTCCGCTCGAGGTGCTGGTGCTGCATGGCGTCAGCCAGGAGCGCATCATTGTATATTCGATGTGGCCAGTGCCGAATACGCACCTAAAGCTCGCCAGGCGGATGCATATTTGGAGCGCCTCCGCTAACCCACAAGAGCTGCGTAGGCCGACACCTTACTGCCAGCACGTTTATT

Full Affymetrix probeset data:

Annotations for 1626353_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720