Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626358_at:

>probe:Drosophila_2:1626358_at:128:189; Interrogation_Position=442; Antisense; AACAGAAGCGCAACAGATTTACCAT
>probe:Drosophila_2:1626358_at:292:461; Interrogation_Position=467; Antisense; GTTTTCCATGGACAATTTCGACTTG
>probe:Drosophila_2:1626358_at:197:69; Interrogation_Position=501; Antisense; ATGGCGCGCCACTTCTTCGAGGGAT
>probe:Drosophila_2:1626358_at:251:717; Interrogation_Position=516; Antisense; TTCGAGGGATCGCAGGCCACCAACG
>probe:Drosophila_2:1626358_at:211:409; Interrogation_Position=603; Antisense; GACGATGCCTATAGCAGTGGCTTCA
>probe:Drosophila_2:1626358_at:493:521; Interrogation_Position=619; Antisense; GTGGCTTCAACAGCGACCAGGAGAA
>probe:Drosophila_2:1626358_at:566:133; Interrogation_Position=807; Antisense; ACGCTGCCCTACGAGAAGCGACTAA
>probe:Drosophila_2:1626358_at:19:207; Interrogation_Position=822; Antisense; AAGCGACTAAGCAAGGTGGACACAC
>probe:Drosophila_2:1626358_at:93:521; Interrogation_Position=837; Antisense; GTGGACACACTCAAGCTGGCCATAA
>probe:Drosophila_2:1626358_at:432:31; Interrogation_Position=867; Antisense; ATAACCTTCCTCAGCGAGATGGTCA
>probe:Drosophila_2:1626358_at:231:383; Interrogation_Position=902; Antisense; GAACGGCAACGAGCCGGGCCTAAGT
>probe:Drosophila_2:1626358_at:364:521; Interrogation_Position=917; Antisense; GGGCCTAAGTCTGCAGCGTAACTAC
>probe:Drosophila_2:1626358_at:426:125; Interrogation_Position=949; Antisense; AGCCGCCCAAGAAAATTATCCTCAA
>probe:Drosophila_2:1626358_at:619:545; Interrogation_Position=974; Antisense; GGATCGCAGTGAGTTGTCAATCAAT

Paste this into a BLAST search page for me
AACAGAAGCGCAACAGATTTACCATGTTTTCCATGGACAATTTCGACTTGATGGCGCGCCACTTCTTCGAGGGATTTCGAGGGATCGCAGGCCACCAACGGACGATGCCTATAGCAGTGGCTTCAGTGGCTTCAACAGCGACCAGGAGAAACGCTGCCCTACGAGAAGCGACTAAAAGCGACTAAGCAAGGTGGACACACGTGGACACACTCAAGCTGGCCATAAATAACCTTCCTCAGCGAGATGGTCAGAACGGCAACGAGCCGGGCCTAAGTGGGCCTAAGTCTGCAGCGTAACTACAGCCGCCCAAGAAAATTATCCTCAAGGATCGCAGTGAGTTGTCAATCAAT

Full Affymetrix probeset data:

Annotations for 1626358_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime