FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626360_at:

>probe:Drosophila_2:1626360_at:394:33; Interrogation_Position=1267; Antisense; ATCAAGGTCCACTCCGGCGTGAAGC
>probe:Drosophila_2:1626360_at:677:507; Interrogation_Position=1299; Antisense; GTGCGAGATCTGTGGTCATTGCTTC
>probe:Drosophila_2:1626360_at:713:491; Interrogation_Position=1424; Antisense; GTAACAAGCACCACAGAATCCACAC
>probe:Drosophila_2:1626360_at:389:417; Interrogation_Position=1453; Antisense; GAGCGACCCTACGAGTGCGATGTTT
>probe:Drosophila_2:1626360_at:679:479; Interrogation_Position=1474; Antisense; GTTTGCCACAAGACATTCACTTACA
>probe:Drosophila_2:1626360_at:72:671; Interrogation_Position=1530; Antisense; TACGGGAGAGAAGCCGCACGTCTGC
>probe:Drosophila_2:1626360_at:364:81; Interrogation_Position=1568; Antisense; AGGGATTCCCGCAGGCGTACAAACT
>probe:Drosophila_2:1626360_at:72:573; Interrogation_Position=1581; Antisense; GGCGTACAAACTGCGTAACCACCGG
>probe:Drosophila_2:1626360_at:598:659; Interrogation_Position=1596; Antisense; TAACCACCGGGTCATCCACGAGAGG
>probe:Drosophila_2:1626360_at:204:487; Interrogation_Position=1645; Antisense; GTAGCCGGGCTGGTGTCCTACGACA
>probe:Drosophila_2:1626360_at:295:187; Interrogation_Position=1675; Antisense; AACATCGTTGGCCTGGATATGTAAA
>probe:Drosophila_2:1626360_at:646:599; Interrogation_Position=1694; Antisense; TGTAAATTTCGAGCGAGGACTCCAC
>probe:Drosophila_2:1626360_at:560:495; Interrogation_Position=1722; Antisense; GTCCCAAAGCGACACTTTACACTTT
>probe:Drosophila_2:1626360_at:457:203; Interrogation_Position=1796; Antisense; AAGCCTAGCCTAATTATGCGGAAAT

Paste this into a BLAST search page for me
ATCAAGGTCCACTCCGGCGTGAAGCGTGCGAGATCTGTGGTCATTGCTTCGTAACAAGCACCACAGAATCCACACGAGCGACCCTACGAGTGCGATGTTTGTTTGCCACAAGACATTCACTTACATACGGGAGAGAAGCCGCACGTCTGCAGGGATTCCCGCAGGCGTACAAACTGGCGTACAAACTGCGTAACCACCGGTAACCACCGGGTCATCCACGAGAGGGTAGCCGGGCTGGTGTCCTACGACAAACATCGTTGGCCTGGATATGTAAATGTAAATTTCGAGCGAGGACTCCACGTCCCAAAGCGACACTTTACACTTTAAGCCTAGCCTAATTATGCGGAAAT

Full Affymetrix probeset data:

Annotations for 1626360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720