Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626362_at:

>probe:Drosophila_2:1626362_at:299:149; Interrogation_Position=2301; Antisense; ACTTTTGCGGCAAGTCTGTGTCCAA
>probe:Drosophila_2:1626362_at:197:597; Interrogation_Position=2317; Antisense; TGTGTCCAACGCCTTGCTGGACGAG
>probe:Drosophila_2:1626362_at:408:619; Interrogation_Position=2417; Antisense; TGCTCGCTCTGCCTAATGCACATGG
>probe:Drosophila_2:1626362_at:423:221; Interrogation_Position=2522; Antisense; AAGTGGTTTTCCTGGTGTCAGACCT
>probe:Drosophila_2:1626362_at:713:397; Interrogation_Position=2559; Antisense; GACACACCGAGCACATCATGCAGTG
>probe:Drosophila_2:1626362_at:666:253; Interrogation_Position=2591; Antisense; CAAAATTCAGAGTGCCCCGTGTCGT
>probe:Drosophila_2:1626362_at:103:289; Interrogation_Position=2644; Antisense; CGGCACCAAGCCGAACACATTGAGA
>probe:Drosophila_2:1626362_at:461:425; Interrogation_Position=2665; Antisense; GAGAGACATTTCCTAGCTGTCCGGA
>probe:Drosophila_2:1626362_at:462:635; Interrogation_Position=2714; Antisense; TCGCCCAGGCCATATGCATATGCAT
>probe:Drosophila_2:1626362_at:715:465; Interrogation_Position=2745; Antisense; GTTGATTTGTTCCAAACGCGTGCGC
>probe:Drosophila_2:1626362_at:521:133; Interrogation_Position=2760; Antisense; ACGCGTGCGCCTTAAACAAACTCAG
>probe:Drosophila_2:1626362_at:42:443; Interrogation_Position=2810; Antisense; GATGTGCCCGTAGCATTAGTGTTTA
>probe:Drosophila_2:1626362_at:113:63; Interrogation_Position=2827; Antisense; AGTGTTTATGACCTACCAGCTTTTA
>probe:Drosophila_2:1626362_at:608:261; Interrogation_Position=2843; Antisense; CAGCTTTTAGCTGCTCAATTGCATT

Paste this into a BLAST search page for me
ACTTTTGCGGCAAGTCTGTGTCCAATGTGTCCAACGCCTTGCTGGACGAGTGCTCGCTCTGCCTAATGCACATGGAAGTGGTTTTCCTGGTGTCAGACCTGACACACCGAGCACATCATGCAGTGCAAAATTCAGAGTGCCCCGTGTCGTCGGCACCAAGCCGAACACATTGAGAGAGAGACATTTCCTAGCTGTCCGGATCGCCCAGGCCATATGCATATGCATGTTGATTTGTTCCAAACGCGTGCGCACGCGTGCGCCTTAAACAAACTCAGGATGTGCCCGTAGCATTAGTGTTTAAGTGTTTATGACCTACCAGCTTTTACAGCTTTTAGCTGCTCAATTGCATT

Full Affymetrix probeset data:

Annotations for 1626362_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime