FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626364_at:

>probe:Drosophila_2:1626364_at:176:63; Interrogation_Position=13; Antisense; ATGTCCATTAGCCTCTCTGAATTCT
>probe:Drosophila_2:1626364_at:385:99; Interrogation_Position=138; Antisense; AGAGGAACTCAACGAACCCTGTGCC
>probe:Drosophila_2:1626364_at:714:27; Interrogation_Position=152; Antisense; AACCCTGTGCCATCTCAAAAACCAT
>probe:Drosophila_2:1626364_at:215:651; Interrogation_Position=166; Antisense; TCAAAAACCATGGACGCCTTCGTGG
>probe:Drosophila_2:1626364_at:291:1; Interrogation_Position=202; Antisense; AAGCGGGTGCAACGAAAATCCCACG
>probe:Drosophila_2:1626364_at:366:387; Interrogation_Position=215; Antisense; GAAAATCCCACGAGTACGCCAAAGT
>probe:Drosophila_2:1626364_at:679:311; Interrogation_Position=232; Antisense; GCCAAAGTGGAGCTACTGCATCGCC
>probe:Drosophila_2:1626364_at:226:587; Interrogation_Position=284; Antisense; TGGAGCAGCGCCGACTCATCCGATT
>probe:Drosophila_2:1626364_at:115:405; Interrogation_Position=296; Antisense; GACTCATCCGATTGGCTCTGGCCAG
>probe:Drosophila_2:1626364_at:361:363; Interrogation_Position=31; Antisense; GAATTCTACCAATCCTCACTGACTT
>probe:Drosophila_2:1626364_at:554:437; Interrogation_Position=321; Antisense; GAGGCGACTGGACTACTCCAATTAG
>probe:Drosophila_2:1626364_at:330:651; Interrogation_Position=46; Antisense; TCACTGACTTTCTGGAGCCATCTGA
>probe:Drosophila_2:1626364_at:300:315; Interrogation_Position=62; Antisense; GCCATCTGATCCATATACTGCTGCA
>probe:Drosophila_2:1626364_at:617:127; Interrogation_Position=97; Antisense; ACCAACTGCTGGAATCACATCACAC

Paste this into a BLAST search page for me
ATGTCCATTAGCCTCTCTGAATTCTAGAGGAACTCAACGAACCCTGTGCCAACCCTGTGCCATCTCAAAAACCATTCAAAAACCATGGACGCCTTCGTGGAAGCGGGTGCAACGAAAATCCCACGGAAAATCCCACGAGTACGCCAAAGTGCCAAAGTGGAGCTACTGCATCGCCTGGAGCAGCGCCGACTCATCCGATTGACTCATCCGATTGGCTCTGGCCAGGAATTCTACCAATCCTCACTGACTTGAGGCGACTGGACTACTCCAATTAGTCACTGACTTTCTGGAGCCATCTGAGCCATCTGATCCATATACTGCTGCAACCAACTGCTGGAATCACATCACAC

Full Affymetrix probeset data:

Annotations for 1626364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720