Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626365_at:

>probe:Drosophila_2:1626365_at:708:1; Interrogation_Position=2192; Antisense; ATTGGACCCACGATGTTGTGGACCA
>probe:Drosophila_2:1626365_at:335:29; Interrogation_Position=2223; Antisense; ATACATTGATTTCCTACGCTGCAAG
>probe:Drosophila_2:1626365_at:171:359; Interrogation_Position=2243; Antisense; GCAAGGTCCTTTCCGACGAGCTAGA
>probe:Drosophila_2:1626365_at:148:75; Interrogation_Position=2308; Antisense; AGGAGCTGCCATTTGGAGTACGTCA
>probe:Drosophila_2:1626365_at:226:549; Interrogation_Position=2322; Antisense; GGAGTACGTCACACTGATCGAACAG
>probe:Drosophila_2:1626365_at:514:385; Interrogation_Position=2341; Antisense; GAACAGTACAAGCAGCGCATCAATA
>probe:Drosophila_2:1626365_at:556:407; Interrogation_Position=2386; Antisense; GACGATATGGAGACGGCCGAGAATA
>probe:Drosophila_2:1626365_at:621:467; Interrogation_Position=2412; Antisense; GTTGCAGGCAACTCTTAATAGGGTG
>probe:Drosophila_2:1626365_at:728:375; Interrogation_Position=2449; Antisense; GAAGACCTGAGGTCCTGCCAGGAAA
>probe:Drosophila_2:1626365_at:175:327; Interrogation_Position=2533; Antisense; GAAAAGGAGCGTGCCCGTTTGTCAG
>probe:Drosophila_2:1626365_at:542:479; Interrogation_Position=2549; Antisense; GTTTGTCAGCTGCACGAGTTTCTAA
>probe:Drosophila_2:1626365_at:4:429; Interrogation_Position=2564; Antisense; GAGTTTCTAAACGAATGTCCCGGAT
>probe:Drosophila_2:1626365_at:340:371; Interrogation_Position=2613; Antisense; GAAGGCTGCCGCACAGCAGGCAAAA
>probe:Drosophila_2:1626365_at:503:365; Interrogation_Position=2677; Antisense; GAATAGTATTATTCCTGCCCAAAGG

Paste this into a BLAST search page for me
ATTGGACCCACGATGTTGTGGACCAATACATTGATTTCCTACGCTGCAAGGCAAGGTCCTTTCCGACGAGCTAGAAGGAGCTGCCATTTGGAGTACGTCAGGAGTACGTCACACTGATCGAACAGGAACAGTACAAGCAGCGCATCAATAGACGATATGGAGACGGCCGAGAATAGTTGCAGGCAACTCTTAATAGGGTGGAAGACCTGAGGTCCTGCCAGGAAAGAAAAGGAGCGTGCCCGTTTGTCAGGTTTGTCAGCTGCACGAGTTTCTAAGAGTTTCTAAACGAATGTCCCGGATGAAGGCTGCCGCACAGCAGGCAAAAGAATAGTATTATTCCTGCCCAAAGG

Full Affymetrix probeset data:

Annotations for 1626365_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime