FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626366_at:

>probe:Drosophila_2:1626366_at:600:203; Interrogation_Position=313; Antisense; AAGCCTTCTAGCCAAAGAACGCCGA
>probe:Drosophila_2:1626366_at:18:533; Interrogation_Position=364; Antisense; GGTGGTATCCGGCAGCAATGCCATA
>probe:Drosophila_2:1626366_at:512:173; Interrogation_Position=503; Antisense; AAAGCGGCTAGCGAGGTGTATTCAC
>probe:Drosophila_2:1626366_at:267:515; Interrogation_Position=518; Antisense; GTGTATTCACCCGTTAGTGGCAAGG
>probe:Drosophila_2:1626366_at:588:575; Interrogation_Position=577; Antisense; GGCCCTAGTCAACAGCAGTTGCTAT
>probe:Drosophila_2:1626366_at:399:573; Interrogation_Position=608; Antisense; GGCTGGCTTTTCAAGGTGGACCTGA
>probe:Drosophila_2:1626366_at:310:367; Interrogation_Position=634; Antisense; GAATCCCAAGGAACTCGAAGCCCTT
>probe:Drosophila_2:1626366_at:403:379; Interrogation_Position=650; Antisense; GAAGCCCTTATGACCGAGGATCAGT
>probe:Drosophila_2:1626366_at:197:491; Interrogation_Position=673; Antisense; GTACAAAGCCTTCCTGAGCAGCAGT
>probe:Drosophila_2:1626366_at:679:527; Interrogation_Position=699; Antisense; GGGATCACTAGAACCAGCAGCTAAT
>probe:Drosophila_2:1626366_at:128:115; Interrogation_Position=735; Antisense; AGCATCTTGACTGTAGCCTTTAAAA
>probe:Drosophila_2:1626366_at:723:655; Interrogation_Position=792; Antisense; TAACGCTACACTCATACCCAAATAT
>probe:Drosophila_2:1626366_at:293:179; Interrogation_Position=825; Antisense; AAACTCATCGCCATACACACGTTGT
>probe:Drosophila_2:1626366_at:391:157; Interrogation_Position=839; Antisense; ACACACGTTGTTGTAGCTCTTGAAA

Paste this into a BLAST search page for me
AAGCCTTCTAGCCAAAGAACGCCGAGGTGGTATCCGGCAGCAATGCCATAAAAGCGGCTAGCGAGGTGTATTCACGTGTATTCACCCGTTAGTGGCAAGGGGCCCTAGTCAACAGCAGTTGCTATGGCTGGCTTTTCAAGGTGGACCTGAGAATCCCAAGGAACTCGAAGCCCTTGAAGCCCTTATGACCGAGGATCAGTGTACAAAGCCTTCCTGAGCAGCAGTGGGATCACTAGAACCAGCAGCTAATAGCATCTTGACTGTAGCCTTTAAAATAACGCTACACTCATACCCAAATATAAACTCATCGCCATACACACGTTGTACACACGTTGTTGTAGCTCTTGAAA

Full Affymetrix probeset data:

Annotations for 1626366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720