FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626367_at:

>probe:Drosophila_2:1626367_at:190:453; Interrogation_Position=1014; Antisense; GATCTATAACATGACCAGCCAATTG
>probe:Drosophila_2:1626367_at:195:127; Interrogation_Position=1030; Antisense; AGCCAATTGACTGGCTTTCCCAATT
>probe:Drosophila_2:1626367_at:395:715; Interrogation_Position=1046; Antisense; TTCCCAATTCGAACGCAAATCCTGG
>probe:Drosophila_2:1626367_at:301:219; Interrogation_Position=1114; Antisense; AAGTGGATAGAATCCCGATCCCCGA
>probe:Drosophila_2:1626367_at:111:545; Interrogation_Position=1148; Antisense; GGATCGGCGGCACACAGATTAAGTT
>probe:Drosophila_2:1626367_at:440:583; Interrogation_Position=1211; Antisense; TGGCTTCTATTACGCATACATACAT
>probe:Drosophila_2:1626367_at:9:233; Interrogation_Position=1272; Antisense; AATGACCGTGCAAATTGCCGCTGTT
>probe:Drosophila_2:1626367_at:353:369; Interrogation_Position=720; Antisense; GAAGGCGGAACAGGCCTACGCCAAG
>probe:Drosophila_2:1626367_at:642:69; Interrogation_Position=743; Antisense; AGGCCATCGAGCTGGAACCGGACAA
>probe:Drosophila_2:1626367_at:202:663; Interrogation_Position=775; Antisense; TACAAGAGCAACCTGGAAGCGGCCA
>probe:Drosophila_2:1626367_at:512:103; Interrogation_Position=843; Antisense; AGACCTAATCAACATGCTGTCCCAG
>probe:Drosophila_2:1626367_at:102:623; Interrogation_Position=857; Antisense; TGCTGTCCCAGCCAATGGTTAGGAA
>probe:Drosophila_2:1626367_at:723:19; Interrogation_Position=881; Antisense; ATTTGTTCAACAACGCCGAGATCGA
>probe:Drosophila_2:1626367_at:162:353; Interrogation_Position=912; Antisense; GCAGCTGCTGTCGATGCTTCAGAAT

Paste this into a BLAST search page for me
GATCTATAACATGACCAGCCAATTGAGCCAATTGACTGGCTTTCCCAATTTTCCCAATTCGAACGCAAATCCTGGAAGTGGATAGAATCCCGATCCCCGAGGATCGGCGGCACACAGATTAAGTTTGGCTTCTATTACGCATACATACATAATGACCGTGCAAATTGCCGCTGTTGAAGGCGGAACAGGCCTACGCCAAGAGGCCATCGAGCTGGAACCGGACAATACAAGAGCAACCTGGAAGCGGCCAAGACCTAATCAACATGCTGTCCCAGTGCTGTCCCAGCCAATGGTTAGGAAATTTGTTCAACAACGCCGAGATCGAGCAGCTGCTGTCGATGCTTCAGAAT

Full Affymetrix probeset data:

Annotations for 1626367_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720