FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626368_at:

>probe:Drosophila_2:1626368_at:649:135; Interrogation_Position=2018; Antisense; ACGAACGGTGGCTTACATTGACCAA
>probe:Drosophila_2:1626368_at:339:7; Interrogation_Position=2034; Antisense; ATTGACCAAGTTTCAGTTGCACTGG
>probe:Drosophila_2:1626368_at:196:469; Interrogation_Position=2049; Antisense; GTTGCACTGGGCTTCTATTTATGAC
>probe:Drosophila_2:1626368_at:589:609; Interrogation_Position=2070; Antisense; TGACTAATTCTCTGGTTATATGCCT
>probe:Drosophila_2:1626368_at:278:527; Interrogation_Position=2100; Antisense; GGGAAGATCACTACAGCAACAGAAA
>probe:Drosophila_2:1626368_at:185:117; Interrogation_Position=2174; Antisense; AGCATTTACCTCTACGTAGTTGTTA
>probe:Drosophila_2:1626368_at:218:231; Interrogation_Position=2211; Antisense; AATCCAATCGTCTTCTTTGGTCGGC
>probe:Drosophila_2:1626368_at:598:589; Interrogation_Position=2228; Antisense; TGGTCGGCTGCTGCATTTTAAGTAT
>probe:Drosophila_2:1626368_at:226:27; Interrogation_Position=2311; Antisense; ATAGCTAAGCTAAGGGAAGCCCCTT
>probe:Drosophila_2:1626368_at:666:697; Interrogation_Position=2335; Antisense; TTTTCGTGGGAAAGCCTCGAGCACC
>probe:Drosophila_2:1626368_at:267:421; Interrogation_Position=2353; Antisense; GAGCACCTCGCTTCTACCAATTAAG
>probe:Drosophila_2:1626368_at:158:207; Interrogation_Position=2384; Antisense; AAGCTGAGCCAAATGTAACGTCTAA
>probe:Drosophila_2:1626368_at:249:35; Interrogation_Position=2431; Antisense; ATCACTATTTGGGTAAGTCTTCGGG
>probe:Drosophila_2:1626368_at:666:1; Interrogation_Position=2466; Antisense; ATTGGGTCAACTTTAGGGCATTGTC

Paste this into a BLAST search page for me
ACGAACGGTGGCTTACATTGACCAAATTGACCAAGTTTCAGTTGCACTGGGTTGCACTGGGCTTCTATTTATGACTGACTAATTCTCTGGTTATATGCCTGGGAAGATCACTACAGCAACAGAAAAGCATTTACCTCTACGTAGTTGTTAAATCCAATCGTCTTCTTTGGTCGGCTGGTCGGCTGCTGCATTTTAAGTATATAGCTAAGCTAAGGGAAGCCCCTTTTTTCGTGGGAAAGCCTCGAGCACCGAGCACCTCGCTTCTACCAATTAAGAAGCTGAGCCAAATGTAACGTCTAAATCACTATTTGGGTAAGTCTTCGGGATTGGGTCAACTTTAGGGCATTGTC

Full Affymetrix probeset data:

Annotations for 1626368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720