FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626369_at:

>probe:Drosophila_2:1626369_at:578:649; Interrogation_Position=111; Antisense; TCACCGATGCGGATGGTAATCTCAT
>probe:Drosophila_2:1626369_at:298:655; Interrogation_Position=127; Antisense; TAATCTCATCAAGAGCATGGCGTTG
>probe:Drosophila_2:1626369_at:168:421; Interrogation_Position=139; Antisense; GAGCATGGCGTTGGACATCTACGAG
>probe:Drosophila_2:1626369_at:276:527; Interrogation_Position=164; Antisense; GGGAGTGCCACCAGTGTCGATGCAC
>probe:Drosophila_2:1626369_at:46:77; Interrogation_Position=176; Antisense; AGTGTCGATGCACAGGTCACCATTT
>probe:Drosophila_2:1626369_at:100:357; Interrogation_Position=185; Antisense; GCACAGGTCACCATTTCCGATGAGG
>probe:Drosophila_2:1626369_at:83:75; Interrogation_Position=207; Antisense; AGGACTTCTACTTGGTGGGCACTAA
>probe:Drosophila_2:1626369_at:350:525; Interrogation_Position=223; Antisense; GGGCACTAAGCAGAAGACTTTCCAG
>probe:Drosophila_2:1626369_at:340:69; Interrogation_Position=279; Antisense; ATGGCGATGAGGAGGCTATCAACAA
>probe:Drosophila_2:1626369_at:93:247; Interrogation_Position=326; Antisense; AATTCTCAAAACTAGCTCGGTGTCA
>probe:Drosophila_2:1626369_at:668:601; Interrogation_Position=403; Antisense; TGTTTATTCACTTCACCCCAATAAT
>probe:Drosophila_2:1626369_at:528:723; Interrogation_Position=56; Antisense; TTGAAGGAATCGGATCCTGCCCGGC
>probe:Drosophila_2:1626369_at:210:303; Interrogation_Position=84; Antisense; CCGTCGTCAACACGTTTCAGTTCAA
>probe:Drosophila_2:1626369_at:7:713; Interrogation_Position=99; Antisense; TTCAGTTCAACTTCACCGATGCGGA

Paste this into a BLAST search page for me
TCACCGATGCGGATGGTAATCTCATTAATCTCATCAAGAGCATGGCGTTGGAGCATGGCGTTGGACATCTACGAGGGGAGTGCCACCAGTGTCGATGCACAGTGTCGATGCACAGGTCACCATTTGCACAGGTCACCATTTCCGATGAGGAGGACTTCTACTTGGTGGGCACTAAGGGCACTAAGCAGAAGACTTTCCAGATGGCGATGAGGAGGCTATCAACAAAATTCTCAAAACTAGCTCGGTGTCATGTTTATTCACTTCACCCCAATAATTTGAAGGAATCGGATCCTGCCCGGCCCGTCGTCAACACGTTTCAGTTCAATTCAGTTCAACTTCACCGATGCGGA

Full Affymetrix probeset data:

Annotations for 1626369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720