FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626371_at:

>probe:Drosophila_2:1626371_at:81:549; Interrogation_Position=1027; Antisense; GGAGTCCATTAAAACCGAATTGCAT
>probe:Drosophila_2:1626371_at:586:723; Interrogation_Position=1046; Antisense; TTGCATCACTTCGAAAGTCGCCTAT
>probe:Drosophila_2:1626371_at:608:663; Interrogation_Position=1071; Antisense; TAAAGCTGCGTCACTTGCATGCCGA
>probe:Drosophila_2:1626371_at:136:271; Interrogation_Position=1088; Antisense; CATGCCGAGCATGCTTTGCAAAAGG
>probe:Drosophila_2:1626371_at:433:207; Interrogation_Position=1144; Antisense; AAGCAGCCGCTTTGAGGAAATGGAG
>probe:Drosophila_2:1626371_at:412:181; Interrogation_Position=1222; Antisense; AAAAACCATCTTCAAGCACACCGAG
>probe:Drosophila_2:1626371_at:1:7; Interrogation_Position=1302; Antisense; ATTGCAACTGTTTGTGTAACGCACA
>probe:Drosophila_2:1626371_at:423:243; Interrogation_Position=1329; Antisense; AATATTCATTCTTGCTGCTATTCAG
>probe:Drosophila_2:1626371_at:226:423; Interrogation_Position=860; Antisense; GAGAACGACCTTAACACTCTGCGAG
>probe:Drosophila_2:1626371_at:333:295; Interrogation_Position=881; Antisense; CGAGGACATCACACGGGCATCAAGG
>probe:Drosophila_2:1626371_at:34:455; Interrogation_Position=905; Antisense; GATCACTACGATAGGCTGGAACGCC
>probe:Drosophila_2:1626371_at:9:495; Interrogation_Position=951; Antisense; GTCAGGACTTCATTGAACCCAAGGT
>probe:Drosophila_2:1626371_at:661:309; Interrogation_Position=969; Antisense; CCAAGGTCCAGGGTCTATGGCGAGT
>probe:Drosophila_2:1626371_at:432:83; Interrogation_Position=991; Antisense; AGTGGCCCAGGCTAGCAATTTTACG

Paste this into a BLAST search page for me
GGAGTCCATTAAAACCGAATTGCATTTGCATCACTTCGAAAGTCGCCTATTAAAGCTGCGTCACTTGCATGCCGACATGCCGAGCATGCTTTGCAAAAGGAAGCAGCCGCTTTGAGGAAATGGAGAAAAACCATCTTCAAGCACACCGAGATTGCAACTGTTTGTGTAACGCACAAATATTCATTCTTGCTGCTATTCAGGAGAACGACCTTAACACTCTGCGAGCGAGGACATCACACGGGCATCAAGGGATCACTACGATAGGCTGGAACGCCGTCAGGACTTCATTGAACCCAAGGTCCAAGGTCCAGGGTCTATGGCGAGTAGTGGCCCAGGCTAGCAATTTTACG

Full Affymetrix probeset data:

Annotations for 1626371_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720