Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626373_at:

>probe:Drosophila_2:1626373_at:717:431; Interrogation_Position=1015; Antisense; GAGTCGCACATGCAGCTCTAAAAAT
>probe:Drosophila_2:1626373_at:678:311; Interrogation_Position=562; Antisense; GCCGAGGTGAAGCTACTTGGCCCTA
>probe:Drosophila_2:1626373_at:410:727; Interrogation_Position=578; Antisense; TTGGCCCTAGCCAGTGCACAGATCT
>probe:Drosophila_2:1626373_at:581:355; Interrogation_Position=593; Antisense; GCACAGATCTGTGGGCGCGAAACAA
>probe:Drosophila_2:1626373_at:606:97; Interrogation_Position=639; Antisense; AGATGACTTGTTCTGCACCGAGAAG
>probe:Drosophila_2:1626373_at:148:217; Interrogation_Position=661; Antisense; AAGTTCGCTAAGGAAGCCTGCTCTT
>probe:Drosophila_2:1626373_at:166:205; Interrogation_Position=674; Antisense; AAGCCTGCTCTTTAGCGATGGGATC
>probe:Drosophila_2:1626373_at:254:441; Interrogation_Position=690; Antisense; GATGGGATCACCTGTGGTCCACAAT
>probe:Drosophila_2:1626373_at:476:65; Interrogation_Position=713; Antisense; ATGGCAAACTGGTCGGCATTATAAC
>probe:Drosophila_2:1626373_at:583:393; Interrogation_Position=738; Antisense; GAAAGGCGGCTGTTCGGAGTATCCA
>probe:Drosophila_2:1626373_at:570:145; Interrogation_Position=820; Antisense; ACTTAAGCGTTCTCCCAATTAATTG
>probe:Drosophila_2:1626373_at:699:239; Interrogation_Position=851; Antisense; AATACTTTGCCTTCGAGCTATGACT
>probe:Drosophila_2:1626373_at:411:83; Interrogation_Position=931; Antisense; AGTAAAGCCATCACTCAATTTGAGG
>probe:Drosophila_2:1626373_at:314:553; Interrogation_Position=973; Antisense; GGAGCTCTAGCCTTGAAAACGACTT

Paste this into a BLAST search page for me
GAGTCGCACATGCAGCTCTAAAAATGCCGAGGTGAAGCTACTTGGCCCTATTGGCCCTAGCCAGTGCACAGATCTGCACAGATCTGTGGGCGCGAAACAAAGATGACTTGTTCTGCACCGAGAAGAAGTTCGCTAAGGAAGCCTGCTCTTAAGCCTGCTCTTTAGCGATGGGATCGATGGGATCACCTGTGGTCCACAATATGGCAAACTGGTCGGCATTATAACGAAAGGCGGCTGTTCGGAGTATCCAACTTAAGCGTTCTCCCAATTAATTGAATACTTTGCCTTCGAGCTATGACTAGTAAAGCCATCACTCAATTTGAGGGGAGCTCTAGCCTTGAAAACGACTT

Full Affymetrix probeset data:

Annotations for 1626373_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime