Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626376_at:

>probe:Drosophila_2:1626376_at:406:363; Interrogation_Position=6305; Antisense; GAATTGTGGTGGACAGCCCTGCAGA
>probe:Drosophila_2:1626376_at:63:351; Interrogation_Position=6325; Antisense; GCAGATGCCACTCACCTGGTAATGA
>probe:Drosophila_2:1626376_at:687:487; Interrogation_Position=6362; Antisense; GTACATGCAAGCTAATCCAGGCCTG
>probe:Drosophila_2:1626376_at:480:335; Interrogation_Position=6386; Antisense; GCTGCCACGTCGATTATGTGCTGAA
>probe:Drosophila_2:1626376_at:707:241; Interrogation_Position=6446; Antisense; AATTTGTGCCTACAGATCCATACCG
>probe:Drosophila_2:1626376_at:711:473; Interrogation_Position=6504; Antisense; GTTCAATCTGAATACCGTGCTGTGC
>probe:Drosophila_2:1626376_at:664:479; Interrogation_Position=6549; Antisense; GTTTGCCGGCAAATACTTCCATGTG
>probe:Drosophila_2:1626376_at:268:513; Interrogation_Position=6583; Antisense; GTGTTCCCAGCTCGCGAAGAAATTA
>probe:Drosophila_2:1626376_at:320:207; Interrogation_Position=6654; Antisense; AAGCGGTGCATCTGTGGCGGAAACA
>probe:Drosophila_2:1626376_at:18:391; Interrogation_Position=6673; Antisense; GAAACACACATGCAAGCGCCCGATT
>probe:Drosophila_2:1626376_at:44:667; Interrogation_Position=6700; Antisense; TACATCATAGTAACCTGTCCCACGG
>probe:Drosophila_2:1626376_at:62:401; Interrogation_Position=6724; Antisense; GACATGCATCTCTGTGCGGATCTCA
>probe:Drosophila_2:1626376_at:658:557; Interrogation_Position=6757; Antisense; GGAAATCCCAAGTGTCATATCGTTT
>probe:Drosophila_2:1626376_at:268:197; Interrogation_Position=6783; Antisense; AACGGAGTTCGTCATGAGCTCGATA

Paste this into a BLAST search page for me
GAATTGTGGTGGACAGCCCTGCAGAGCAGATGCCACTCACCTGGTAATGAGTACATGCAAGCTAATCCAGGCCTGGCTGCCACGTCGATTATGTGCTGAAAATTTGTGCCTACAGATCCATACCGGTTCAATCTGAATACCGTGCTGTGCGTTTGCCGGCAAATACTTCCATGTGGTGTTCCCAGCTCGCGAAGAAATTAAAGCGGTGCATCTGTGGCGGAAACAGAAACACACATGCAAGCGCCCGATTTACATCATAGTAACCTGTCCCACGGGACATGCATCTCTGTGCGGATCTCAGGAAATCCCAAGTGTCATATCGTTTAACGGAGTTCGTCATGAGCTCGATA

Full Affymetrix probeset data:

Annotations for 1626376_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime