FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626377_at:

>probe:Drosophila_2:1626377_at:263:467; Interrogation_Position=1623; Antisense; GTTGGTCATGAACTCATCCACGGCT
>probe:Drosophila_2:1626377_at:499:413; Interrogation_Position=1655; Antisense; GACCAGCTCCTATTTCGATGGCAAT
>probe:Drosophila_2:1626377_at:30:567; Interrogation_Position=1674; Antisense; GGCAATGGTCACATGGAGTCCTTGT
>probe:Drosophila_2:1626377_at:350:431; Interrogation_Position=1689; Antisense; GAGTCCTTGTTGTCGGAAATTTCGC
>probe:Drosophila_2:1626377_at:384:323; Interrogation_Position=1732; Antisense; GCGCCGAGTGCTACATGGACTACTA
>probe:Drosophila_2:1626377_at:554:487; Interrogation_Position=1770; Antisense; GTACCGGAGATCAGCAGGCGTGTCA
>probe:Drosophila_2:1626377_at:218:397; Interrogation_Position=1843; Antisense; GACAAGCATTGACGGCCTATCGCAG
>probe:Drosophila_2:1626377_at:607:111; Interrogation_Position=1876; Antisense; AGCAACTGCTGGAGCATCCTGGGCA
>probe:Drosophila_2:1626377_at:361:453; Interrogation_Position=1932; Antisense; GATCTCACGCCGGAACAGTTGTTCT
>probe:Drosophila_2:1626377_at:427:89; Interrogation_Position=1948; Antisense; AGTTGTTCTTCCTGGGATTTGCCCA
>probe:Drosophila_2:1626377_at:46:117; Interrogation_Position=1972; Antisense; AGCTATTTTGCTCCCATTACGAGGA
>probe:Drosophila_2:1626377_at:68:497; Interrogation_Position=2014; Antisense; GTCTTAGCGATGTGCACACCTTCGA
>probe:Drosophila_2:1626377_at:629:411; Interrogation_Position=2037; Antisense; GACCAATTTCGTGTCCTGGGAGTTT
>probe:Drosophila_2:1626377_at:247:177; Interrogation_Position=2131; Antisense; AAACGTGCCGACTTTGGTAGATCAT

Paste this into a BLAST search page for me
GTTGGTCATGAACTCATCCACGGCTGACCAGCTCCTATTTCGATGGCAATGGCAATGGTCACATGGAGTCCTTGTGAGTCCTTGTTGTCGGAAATTTCGCGCGCCGAGTGCTACATGGACTACTAGTACCGGAGATCAGCAGGCGTGTCAGACAAGCATTGACGGCCTATCGCAGAGCAACTGCTGGAGCATCCTGGGCAGATCTCACGCCGGAACAGTTGTTCTAGTTGTTCTTCCTGGGATTTGCCCAAGCTATTTTGCTCCCATTACGAGGAGTCTTAGCGATGTGCACACCTTCGAGACCAATTTCGTGTCCTGGGAGTTTAAACGTGCCGACTTTGGTAGATCAT

Full Affymetrix probeset data:

Annotations for 1626377_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720