Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626379_a_at:

>probe:Drosophila_2:1626379_a_at:131:519; Interrogation_Position=112; Antisense; GTGGAAGAATAGTACCTGCGAAATA
>probe:Drosophila_2:1626379_a_at:279:529; Interrogation_Position=166; Antisense; GGAAACCAAGTATACCAAAAATCAG
>probe:Drosophila_2:1626379_a_at:560:237; Interrogation_Position=185; Antisense; AATCAGGCAGGTCAGCAGTCTTGGA
>probe:Drosophila_2:1626379_a_at:225:349; Interrogation_Position=191; Antisense; GCAGGTCAGCAGTCTTGGAAGTCAA
>probe:Drosophila_2:1626379_a_at:72:563; Interrogation_Position=207; Antisense; GGAAGTCAATTCACTTTTCCCAATA
>probe:Drosophila_2:1626379_a_at:25:259; Interrogation_Position=218; Antisense; CACTTTTCCCAATATAGCGGATCTA
>probe:Drosophila_2:1626379_a_at:102:543; Interrogation_Position=236; Antisense; GGATCTATTTTGCAATGCCGTCTCC
>probe:Drosophila_2:1626379_a_at:295:625; Interrogation_Position=251; Antisense; TGCCGTCTCCATTCACAATGACTAT
>probe:Drosophila_2:1626379_a_at:394:181; Interrogation_Position=298; Antisense; AAAAGTTGCAATTCCATTTAAATGG
>probe:Drosophila_2:1626379_a_at:188:619; Interrogation_Position=341; Antisense; TGCTTCAGCGATTTACTATTTTAAG
>probe:Drosophila_2:1626379_a_at:257:357; Interrogation_Position=365; Antisense; GCAACATATTATTCTAAACTCGGAT
>probe:Drosophila_2:1626379_a_at:356:193; Interrogation_Position=381; Antisense; AACTCGGATCAACTGGAATCTGCAT
>probe:Drosophila_2:1626379_a_at:494:611; Interrogation_Position=416; Antisense; TGACATGACCTTTCATACAATAATG
>probe:Drosophila_2:1626379_a_at:512:29; Interrogation_Position=91; Antisense; ATACATTCCGAGCAATTTTCAGTGG

Paste this into a BLAST search page for me
GTGGAAGAATAGTACCTGCGAAATAGGAAACCAAGTATACCAAAAATCAGAATCAGGCAGGTCAGCAGTCTTGGAGCAGGTCAGCAGTCTTGGAAGTCAAGGAAGTCAATTCACTTTTCCCAATACACTTTTCCCAATATAGCGGATCTAGGATCTATTTTGCAATGCCGTCTCCTGCCGTCTCCATTCACAATGACTATAAAAGTTGCAATTCCATTTAAATGGTGCTTCAGCGATTTACTATTTTAAGGCAACATATTATTCTAAACTCGGATAACTCGGATCAACTGGAATCTGCATTGACATGACCTTTCATACAATAATGATACATTCCGAGCAATTTTCAGTGG

Full Affymetrix probeset data:

Annotations for 1626379_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime