Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626382_s_at:

>probe:Drosophila_2:1626382_s_at:532:453; Interrogation_Position=1048; Antisense; GATAATGGTCCCTCAACTCAATGTT
>probe:Drosophila_2:1626382_s_at:189:193; Interrogation_Position=1062; Antisense; AACTCAATGTTCGTTTCGTCCGAAG
>probe:Drosophila_2:1626382_s_at:392:727; Interrogation_Position=1116; Antisense; TTGTTTGCCACAGTAACACACCCAA
>probe:Drosophila_2:1626382_s_at:433:125; Interrogation_Position=603; Antisense; AGCCGCACGTTCCTTGCTGGAGAAC
>probe:Drosophila_2:1626382_s_at:276:73; Interrogation_Position=647; Antisense; AGGAAGCCGGCGAGGATACCACTCT
>probe:Drosophila_2:1626382_s_at:173:79; Interrogation_Position=659; Antisense; AGGATACCACTCTCATCGAGCTCAA
>probe:Drosophila_2:1626382_s_at:669:623; Interrogation_Position=689; Antisense; TGCGCGAGCGCGTCCAGGAGCTAAC
>probe:Drosophila_2:1626382_s_at:167:279; Interrogation_Position=709; Antisense; CTAACCTCCGACTTGAATCGCGAAA
>probe:Drosophila_2:1626382_s_at:600:551; Interrogation_Position=765; Antisense; GGAGAGCATCAACCGCGAGTACGAC
>probe:Drosophila_2:1626382_s_at:79:431; Interrogation_Position=781; Antisense; GAGTACGACCGACTCACCGAGGAGT
>probe:Drosophila_2:1626382_s_at:109:649; Interrogation_Position=794; Antisense; TCACCGAGGAGTACAGCAAGCTGCA
>probe:Drosophila_2:1626382_s_at:118:661; Interrogation_Position=827; Antisense; TAACCATCGGCGGAGGCGGAAACAA
>probe:Drosophila_2:1626382_s_at:685:145; Interrogation_Position=862; Antisense; ACTCACTGGAGCCAAGTCCAACATT
>probe:Drosophila_2:1626382_s_at:180:525; Interrogation_Position=920; Antisense; GGGCAGCGAAAGCAGGCACATTTAA

Paste this into a BLAST search page for me
GATAATGGTCCCTCAACTCAATGTTAACTCAATGTTCGTTTCGTCCGAAGTTGTTTGCCACAGTAACACACCCAAAGCCGCACGTTCCTTGCTGGAGAACAGGAAGCCGGCGAGGATACCACTCTAGGATACCACTCTCATCGAGCTCAATGCGCGAGCGCGTCCAGGAGCTAACCTAACCTCCGACTTGAATCGCGAAAGGAGAGCATCAACCGCGAGTACGACGAGTACGACCGACTCACCGAGGAGTTCACCGAGGAGTACAGCAAGCTGCATAACCATCGGCGGAGGCGGAAACAAACTCACTGGAGCCAAGTCCAACATTGGGCAGCGAAAGCAGGCACATTTAA

Full Affymetrix probeset data:

Annotations for 1626382_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime