Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626383_at:

>probe:Drosophila_2:1626383_at:403:307; Interrogation_Position=2824; Antisense; CCATCCAGCATTCCATATCGTTATA
>probe:Drosophila_2:1626383_at:407:421; Interrogation_Position=2870; Antisense; GAGCAACGCTGGCATTTTCTACGAG
>probe:Drosophila_2:1626383_at:654:369; Interrogation_Position=2912; Antisense; GAATGTGACCGCTGGCAGGCAGTTC
>probe:Drosophila_2:1626383_at:206:569; Interrogation_Position=2929; Antisense; GGCAGTTCCAGTGGCGCCTGAGCAA
>probe:Drosophila_2:1626383_at:205:513; Interrogation_Position=2998; Antisense; GTGAGCCCATCTGCCAGGAGAACGG
>probe:Drosophila_2:1626383_at:521:379; Interrogation_Position=3039; Antisense; GAACCGTTCCAACGAATCGTGTCCA
>probe:Drosophila_2:1626383_at:290:177; Interrogation_Position=3066; Antisense; AAACGCAATCTTCTCATAGCCTTGG
>probe:Drosophila_2:1626383_at:532:25; Interrogation_Position=3081; Antisense; ATAGCCTTGGGTGATACGCTGCCCT
>probe:Drosophila_2:1626383_at:162:253; Interrogation_Position=3119; Antisense; CAAGAACAAGAGACCGGCCCGGCAA
>probe:Drosophila_2:1626383_at:520:535; Interrogation_Position=3189; Antisense; GGTCCTTGGCAATTTTGTCCGGTCA
>probe:Drosophila_2:1626383_at:525:505; Interrogation_Position=3220; Antisense; GTCCAGTTGGATTTGTGGCGCCACC
>probe:Drosophila_2:1626383_at:435:581; Interrogation_Position=3292; Antisense; TGGCCGATGCCGAATGTGGTCACCT
>probe:Drosophila_2:1626383_at:61:591; Interrogation_Position=3308; Antisense; TGGTCACCTGCAGAAGCCGGCGGAA
>probe:Drosophila_2:1626383_at:325:559; Interrogation_Position=3329; Antisense; GGAAATGGAGCCCTGCGAATCCTCG

Paste this into a BLAST search page for me
CCATCCAGCATTCCATATCGTTATAGAGCAACGCTGGCATTTTCTACGAGGAATGTGACCGCTGGCAGGCAGTTCGGCAGTTCCAGTGGCGCCTGAGCAAGTGAGCCCATCTGCCAGGAGAACGGGAACCGTTCCAACGAATCGTGTCCAAAACGCAATCTTCTCATAGCCTTGGATAGCCTTGGGTGATACGCTGCCCTCAAGAACAAGAGACCGGCCCGGCAAGGTCCTTGGCAATTTTGTCCGGTCAGTCCAGTTGGATTTGTGGCGCCACCTGGCCGATGCCGAATGTGGTCACCTTGGTCACCTGCAGAAGCCGGCGGAAGGAAATGGAGCCCTGCGAATCCTCG

Full Affymetrix probeset data:

Annotations for 1626383_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime