Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626384_at:

>probe:Drosophila_2:1626384_at:394:473; Interrogation_Position=1789; Antisense; GTTCTTCAAAACGTGATTCGCCTGC
>probe:Drosophila_2:1626384_at:205:171; Interrogation_Position=1848; Antisense; AAAGTCCCGGGATGAACTGCAGCTG
>probe:Drosophila_2:1626384_at:706:283; Interrogation_Position=1870; Antisense; CTGCTCCTTGCGATGCTGAATATCA
>probe:Drosophila_2:1626384_at:617:437; Interrogation_Position=1908; Antisense; GAGGCTCCAGTTTATTGGGTCATTA
>probe:Drosophila_2:1626384_at:648:213; Interrogation_Position=1936; Antisense; AAGAGATCACCATTCCAGGAGCAGG
>probe:Drosophila_2:1626384_at:452:481; Interrogation_Position=1970; Antisense; GTATGTTCGAGGAGGCCCACAGACT
>probe:Drosophila_2:1626384_at:199:389; Interrogation_Position=2023; Antisense; GAAAACCATGCCCTAGGATCCACAG
>probe:Drosophila_2:1626384_at:373:229; Interrogation_Position=2067; Antisense; AATGGGCAACCATATTCAGCACTTG
>probe:Drosophila_2:1626384_at:509:617; Interrogation_Position=2090; Antisense; TGCACGAGATGCTAGGTATACCTGT
>probe:Drosophila_2:1626384_at:251:483; Interrogation_Position=2105; Antisense; GTATACCTGTGATATCTAATCCCCA
>probe:Drosophila_2:1626384_at:403:517; Interrogation_Position=2150; Antisense; GTGTGTCCTTTGTGGAGATCTCCCT
>probe:Drosophila_2:1626384_at:626:45; Interrogation_Position=2215; Antisense; ATCCTATTCGAGCTGGACAATCTGC
>probe:Drosophila_2:1626384_at:583:611; Interrogation_Position=2267; Antisense; TGACATGTCCCGTTTGCCATGGAAG
>probe:Drosophila_2:1626384_at:287:563; Interrogation_Position=2287; Antisense; GGAAGCTTTGCCACGGAAATGTTTA

Paste this into a BLAST search page for me
GTTCTTCAAAACGTGATTCGCCTGCAAAGTCCCGGGATGAACTGCAGCTGCTGCTCCTTGCGATGCTGAATATCAGAGGCTCCAGTTTATTGGGTCATTAAAGAGATCACCATTCCAGGAGCAGGGTATGTTCGAGGAGGCCCACAGACTGAAAACCATGCCCTAGGATCCACAGAATGGGCAACCATATTCAGCACTTGTGCACGAGATGCTAGGTATACCTGTGTATACCTGTGATATCTAATCCCCAGTGTGTCCTTTGTGGAGATCTCCCTATCCTATTCGAGCTGGACAATCTGCTGACATGTCCCGTTTGCCATGGAAGGGAAGCTTTGCCACGGAAATGTTTA

Full Affymetrix probeset data:

Annotations for 1626384_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime