FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626386_at:

>probe:Drosophila_2:1626386_at:69:219; Interrogation_Position=117; Antisense; AAGTCCGTATGTGTTCAGCTACCAA
>probe:Drosophila_2:1626386_at:34:65; Interrogation_Position=161; Antisense; ATGTGGATCGCCAGCATACCGAGGT
>probe:Drosophila_2:1626386_at:29:115; Interrogation_Position=173; Antisense; AGCATACCGAGGTGTCCGATGGATC
>probe:Drosophila_2:1626386_at:61:509; Interrogation_Position=212; Antisense; GTGCTTTCTCCTATGTGGACCCAAA
>probe:Drosophila_2:1626386_at:635:79; Interrogation_Position=242; Antisense; AGGTGCGCACCGTACAGTATGTGGC
>probe:Drosophila_2:1626386_at:292:445; Interrogation_Position=268; Antisense; GATGAGCATGGTTTCCATCCTCAGC
>probe:Drosophila_2:1626386_at:530:47; Interrogation_Position=284; Antisense; ATCCTCAGCTTAGCCACAAACTGGA
>probe:Drosophila_2:1626386_at:557:149; Interrogation_Position=344; Antisense; ACTTCGCGGCCTACAATCGGATTGC
>probe:Drosophila_2:1626386_at:517:463; Interrogation_Position=363; Antisense; GATTGCGCAAGAGCATGCCAACCAC
>probe:Drosophila_2:1626386_at:139:135; Interrogation_Position=388; Antisense; ACGCCAGGCCAAGTTGCACTAGCAA
>probe:Drosophila_2:1626386_at:448:109; Interrogation_Position=452; Antisense; AGAAGCACCTGAGCGCCTTCGAGCG
>probe:Drosophila_2:1626386_at:522:135; Interrogation_Position=491; Antisense; ACGCGGCCATTGGACGCCAACAGGA
>probe:Drosophila_2:1626386_at:558:187; Interrogation_Position=509; Antisense; AACAGGAGGCACAGCGTCTGGCGCT
>probe:Drosophila_2:1626386_at:539:163; Interrogation_Position=616; Antisense; AAACGGGTAGCTTCCAGAAATATCA

Paste this into a BLAST search page for me
AAGTCCGTATGTGTTCAGCTACCAAATGTGGATCGCCAGCATACCGAGGTAGCATACCGAGGTGTCCGATGGATCGTGCTTTCTCCTATGTGGACCCAAAAGGTGCGCACCGTACAGTATGTGGCGATGAGCATGGTTTCCATCCTCAGCATCCTCAGCTTAGCCACAAACTGGAACTTCGCGGCCTACAATCGGATTGCGATTGCGCAAGAGCATGCCAACCACACGCCAGGCCAAGTTGCACTAGCAAAGAAGCACCTGAGCGCCTTCGAGCGACGCGGCCATTGGACGCCAACAGGAAACAGGAGGCACAGCGTCTGGCGCTAAACGGGTAGCTTCCAGAAATATCA

Full Affymetrix probeset data:

Annotations for 1626386_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720