FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626388_at:

>probe:Drosophila_2:1626388_at:569:371; Interrogation_Position=1045; Antisense; GAAGGCAAAGTTAAATCTCCAGGAT
>probe:Drosophila_2:1626388_at:684:631; Interrogation_Position=1060; Antisense; TCTCCAGGATTACATGAAATTCGTT
>probe:Drosophila_2:1626388_at:339:167; Interrogation_Position=1088; Antisense; AAATGCGAACATTACCAGGTCTGAG
>probe:Drosophila_2:1626388_at:511:79; Interrogation_Position=1104; Antisense; AGGTCTGAGTCCTGACAGCCCACAA
>probe:Drosophila_2:1626388_at:625:157; Interrogation_Position=1125; Antisense; ACAACTCACATTTGAAGGCCTAACT
>probe:Drosophila_2:1626388_at:480:369; Interrogation_Position=1138; Antisense; GAAGGCCTAACTAATCACGATACTC
>probe:Drosophila_2:1626388_at:192:651; Interrogation_Position=1152; Antisense; TCACGATACTCACCTATCACACAAT
>probe:Drosophila_2:1626388_at:531:119; Interrogation_Position=1231; Antisense; AGCTGTGATACATCTGGGCAGGTAA
>probe:Drosophila_2:1626388_at:563:461; Interrogation_Position=1276; Antisense; GATTATGTGAATCATCTCGCACACA
>probe:Drosophila_2:1626388_at:599:265; Interrogation_Position=718; Antisense; CAGTTCTTGGTTCACACATCAAAGA
>probe:Drosophila_2:1626388_at:400:289; Interrogation_Position=751; Antisense; CGTCCCCACGTAATTATACAAATTG
>probe:Drosophila_2:1626388_at:168:387; Interrogation_Position=896; Antisense; GAACAAGAACCTATACAACGCGTAT
>probe:Drosophila_2:1626388_at:501:253; Interrogation_Position=911; Antisense; CAACGCGTATTCATCTAAAGCGATT
>probe:Drosophila_2:1626388_at:399:111; Interrogation_Position=979; Antisense; AGCAATACACTTTATTTTTGACCAC

Paste this into a BLAST search page for me
GAAGGCAAAGTTAAATCTCCAGGATTCTCCAGGATTACATGAAATTCGTTAAATGCGAACATTACCAGGTCTGAGAGGTCTGAGTCCTGACAGCCCACAAACAACTCACATTTGAAGGCCTAACTGAAGGCCTAACTAATCACGATACTCTCACGATACTCACCTATCACACAATAGCTGTGATACATCTGGGCAGGTAAGATTATGTGAATCATCTCGCACACACAGTTCTTGGTTCACACATCAAAGACGTCCCCACGTAATTATACAAATTGGAACAAGAACCTATACAACGCGTATCAACGCGTATTCATCTAAAGCGATTAGCAATACACTTTATTTTTGACCAC

Full Affymetrix probeset data:

Annotations for 1626388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720