FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626389_at:

>probe:Drosophila_2:1626389_at:218:699; Interrogation_Position=1257; Antisense; TTTTTCGGGAGCTGTAACTATTTCA
>probe:Drosophila_2:1626389_at:328:527; Interrogation_Position=1263; Antisense; GGGAGCTGTAACTATTTCAATATTC
>probe:Drosophila_2:1626389_at:603:243; Interrogation_Position=1281; Antisense; AATATTCGAGAATCACCTGTCAAGT
>probe:Drosophila_2:1626389_at:144:423; Interrogation_Position=1288; Antisense; GAGAATCACCTGTCAAGTTATTTAA
>probe:Drosophila_2:1626389_at:36:241; Interrogation_Position=1301; Antisense; CAAGTTATTTAAGACGTGTTAGCAA
>probe:Drosophila_2:1626389_at:84:407; Interrogation_Position=1313; Antisense; GACGTGTTAGCAATATTCTTCGAGG
>probe:Drosophila_2:1626389_at:175:19; Interrogation_Position=1325; Antisense; ATATTCTTCGAGGATTTTACAGCAC
>probe:Drosophila_2:1626389_at:444:461; Interrogation_Position=1337; Antisense; GATTTTACAGCACAATTACGGACCT
>probe:Drosophila_2:1626389_at:685:665; Interrogation_Position=1342; Antisense; TACAGCACAATTACGGACCTTATAT
>probe:Drosophila_2:1626389_at:192:243; Interrogation_Position=1350; Antisense; AATTACGGACCTTATATTTGCAGTT
>probe:Drosophila_2:1626389_at:206:671; Interrogation_Position=1353; Antisense; TACGGACCTTATATTTGCAGTTTTT
>probe:Drosophila_2:1626389_at:70:615; Interrogation_Position=1368; Antisense; TGCAGTTTTTAAAGAATTTCAGGCG
>probe:Drosophila_2:1626389_at:299:1; Interrogation_Position=1387; Antisense; CAGGCGGTAATAGAAGATGTAAGTT
>probe:Drosophila_2:1626389_at:179:439; Interrogation_Position=1402; Antisense; GATGTAAGTTTAACTCATACTCATT

Paste this into a BLAST search page for me
TTTTTCGGGAGCTGTAACTATTTCAGGGAGCTGTAACTATTTCAATATTCAATATTCGAGAATCACCTGTCAAGTGAGAATCACCTGTCAAGTTATTTAACAAGTTATTTAAGACGTGTTAGCAAGACGTGTTAGCAATATTCTTCGAGGATATTCTTCGAGGATTTTACAGCACGATTTTACAGCACAATTACGGACCTTACAGCACAATTACGGACCTTATATAATTACGGACCTTATATTTGCAGTTTACGGACCTTATATTTGCAGTTTTTTGCAGTTTTTAAAGAATTTCAGGCGCAGGCGGTAATAGAAGATGTAAGTTGATGTAAGTTTAACTCATACTCATT

Full Affymetrix probeset data:

Annotations for 1626389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720