Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626390_at:

>probe:Drosophila_2:1626390_at:316:73; Interrogation_Position=1994; Antisense; AGGAAACTCGCATTCGGAAATCGGC
>probe:Drosophila_2:1626390_at:93:269; Interrogation_Position=2052; Antisense; CATGGAGCACTCTACGTTGGACTTT
>probe:Drosophila_2:1626390_at:194:693; Interrogation_Position=2074; Antisense; TTTGTGGCACCCGACGAAAGCATAT
>probe:Drosophila_2:1626390_at:175:191; Interrogation_Position=2091; Antisense; AAGCATATTCAACTACTGGACGGAT
>probe:Drosophila_2:1626390_at:135:365; Interrogation_Position=2117; Antisense; GAATAAACGCGCTGCTGGGTCAACC
>probe:Drosophila_2:1626390_at:201:531; Interrogation_Position=2133; Antisense; GGGTCAACCGATGGTCAGCAAGCAA
>probe:Drosophila_2:1626390_at:56:109; Interrogation_Position=2159; Antisense; AGAACGAGGACTTCGACACTCTGCT
>probe:Drosophila_2:1626390_at:315:157; Interrogation_Position=2174; Antisense; ACACTCTGCTGTCGATGGAGATCAA
>probe:Drosophila_2:1626390_at:177:163; Interrogation_Position=2197; Antisense; AAATTGCGCCTGCTGGACACGGAAG
>probe:Drosophila_2:1626390_at:9:661; Interrogation_Position=2299; Antisense; TAACGAGCACAATTACTTCACGAAT
>probe:Drosophila_2:1626390_at:677:701; Interrogation_Position=2323; Antisense; TTATTCGATTCATTCTAGACTCCCC
>probe:Drosophila_2:1626390_at:721:9; Interrogation_Position=2392; Antisense; ATTCTCCGATCTGATCTTCTACTAG
>probe:Drosophila_2:1626390_at:329:481; Interrogation_Position=2416; Antisense; GTATTACTTGTGCAATTCCCCGAAC
>probe:Drosophila_2:1626390_at:582:199; Interrogation_Position=2481; Antisense; AACCGCTGCCTAGCCATTTAGTGAA

Paste this into a BLAST search page for me
AGGAAACTCGCATTCGGAAATCGGCCATGGAGCACTCTACGTTGGACTTTTTTGTGGCACCCGACGAAAGCATATAAGCATATTCAACTACTGGACGGATGAATAAACGCGCTGCTGGGTCAACCGGGTCAACCGATGGTCAGCAAGCAAAGAACGAGGACTTCGACACTCTGCTACACTCTGCTGTCGATGGAGATCAAAAATTGCGCCTGCTGGACACGGAAGTAACGAGCACAATTACTTCACGAATTTATTCGATTCATTCTAGACTCCCCATTCTCCGATCTGATCTTCTACTAGGTATTACTTGTGCAATTCCCCGAACAACCGCTGCCTAGCCATTTAGTGAA

Full Affymetrix probeset data:

Annotations for 1626390_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime