FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626393_at:

>probe:Drosophila_2:1626393_at:93:109; Interrogation_Position=1006; Antisense; AGAACCAGGAACTAGCATTGCGGGA
>probe:Drosophila_2:1626393_at:398:729; Interrogation_Position=1107; Antisense; TTGTGTTCATCCAAGGTTGCCAACC
>probe:Drosophila_2:1626393_at:523:441; Interrogation_Position=1153; Antisense; GATAAGTTTGGTTTCGCAGGCTAAT
>probe:Drosophila_2:1626393_at:118:117; Interrogation_Position=1204; Antisense; AGCTCAGTGCCAAGTTTTTAACCAG
>probe:Drosophila_2:1626393_at:402:709; Interrogation_Position=1221; Antisense; TTAACCAGGGCCCATAACCAGTCAA
>probe:Drosophila_2:1626393_at:213:647; Interrogation_Position=1242; Antisense; TCAAACAAGACGCTCTATCTCCAAA
>probe:Drosophila_2:1626393_at:718:209; Interrogation_Position=1276; Antisense; AAGAAGATTGCCAGCGCTTGACCTT
>probe:Drosophila_2:1626393_at:260:395; Interrogation_Position=1338; Antisense; GAAATCTTCATTTCCGCTAAACAGA
>probe:Drosophila_2:1626393_at:197:229; Interrogation_Position=1359; Antisense; CAGAATCTCTTTTCGTACTAACCTT
>probe:Drosophila_2:1626393_at:45:409; Interrogation_Position=1415; Antisense; GACGGATTCATTTTGCTACGCATGT
>probe:Drosophila_2:1626393_at:36:173; Interrogation_Position=854; Antisense; AAAGAAGCCCGAGCGTGGCACATGC
>probe:Drosophila_2:1626393_at:359:153; Interrogation_Position=873; Antisense; ACATGCACCCGATGTGGCTTCGTTT
>probe:Drosophila_2:1626393_at:169:479; Interrogation_Position=894; Antisense; GTTTCCTCACAGCAGCCGTGCAAGG
>probe:Drosophila_2:1626393_at:100:621; Interrogation_Position=921; Antisense; TGCGTCCTTCTCGAGGGTCTAAATA

Paste this into a BLAST search page for me
AGAACCAGGAACTAGCATTGCGGGATTGTGTTCATCCAAGGTTGCCAACCGATAAGTTTGGTTTCGCAGGCTAATAGCTCAGTGCCAAGTTTTTAACCAGTTAACCAGGGCCCATAACCAGTCAATCAAACAAGACGCTCTATCTCCAAAAAGAAGATTGCCAGCGCTTGACCTTGAAATCTTCATTTCCGCTAAACAGACAGAATCTCTTTTCGTACTAACCTTGACGGATTCATTTTGCTACGCATGTAAAGAAGCCCGAGCGTGGCACATGCACATGCACCCGATGTGGCTTCGTTTGTTTCCTCACAGCAGCCGTGCAAGGTGCGTCCTTCTCGAGGGTCTAAATA

Full Affymetrix probeset data:

Annotations for 1626393_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720