Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626394_at:

>probe:Drosophila_2:1626394_at:267:347; Interrogation_Position=826; Antisense; GCATCTCGTACTAAGTGAATGAGCA
>probe:Drosophila_2:1626394_at:350:369; Interrogation_Position=842; Antisense; GAATGAGCAGTAACGAATTTAGCAA
>probe:Drosophila_2:1626394_at:550:419; Interrogation_Position=846; Antisense; GAGCAGTAACGAATTTAGCAAATTT
>probe:Drosophila_2:1626394_at:649:15; Interrogation_Position=867; Antisense; ATTTTAAAGAACACTCTGTCTGCAG
>probe:Drosophila_2:1626394_at:452:695; Interrogation_Position=869; Antisense; TTTAAAGAACACTCTGTCTGCAGTC
>probe:Drosophila_2:1626394_at:610:663; Interrogation_Position=871; Antisense; TAAAGAACACTCTGTCTGCAGTCAT
>probe:Drosophila_2:1626394_at:343:211; Interrogation_Position=873; Antisense; AAGAACACTCTGTCTGCAGTCATTT
>probe:Drosophila_2:1626394_at:289:387; Interrogation_Position=875; Antisense; GAACACTCTGTCTGCAGTCATTTAG
>probe:Drosophila_2:1626394_at:161:157; Interrogation_Position=877; Antisense; ACACTCTGTCTGCAGTCATTTAGAT
>probe:Drosophila_2:1626394_at:556:281; Interrogation_Position=880; Antisense; CTCTGTCTGCAGTCATTTAGATTAC
>probe:Drosophila_2:1626394_at:459:499; Interrogation_Position=884; Antisense; GTCTGCAGTCATTTAGATTACGGAT
>probe:Drosophila_2:1626394_at:37:97; Interrogation_Position=898; Antisense; AGATTACGGATGAGAGACTCCAAAT
>probe:Drosophila_2:1626394_at:574:425; Interrogation_Position=909; Antisense; GAGAGACTCCAAATAAATAATTGCA
>probe:Drosophila_2:1626394_at:524:247; Interrogation_Position=927; Antisense; AATTGCAATGAGAATATAACCACCT

Paste this into a BLAST search page for me
GCATCTCGTACTAAGTGAATGAGCAGAATGAGCAGTAACGAATTTAGCAAGAGCAGTAACGAATTTAGCAAATTTATTTTAAAGAACACTCTGTCTGCAGTTTAAAGAACACTCTGTCTGCAGTCTAAAGAACACTCTGTCTGCAGTCATAAGAACACTCTGTCTGCAGTCATTTGAACACTCTGTCTGCAGTCATTTAGACACTCTGTCTGCAGTCATTTAGATCTCTGTCTGCAGTCATTTAGATTACGTCTGCAGTCATTTAGATTACGGATAGATTACGGATGAGAGACTCCAAATGAGAGACTCCAAATAAATAATTGCAAATTGCAATGAGAATATAACCACCT

Full Affymetrix probeset data:

Annotations for 1626394_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime