Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626397_at:

>probe:Drosophila_2:1626397_at:484:217; Interrogation_Position=26935; Antisense; AAGTATTTGTGCGTTCTCGATGAAC
>probe:Drosophila_2:1626397_at:419:55; Interrogation_Position=26954; Antisense; ATGAACGTTCACACAGCGGAATCCT
>probe:Drosophila_2:1626397_at:479:321; Interrogation_Position=26969; Antisense; GCGGAATCCTAAGCTACTTCGGATA
>probe:Drosophila_2:1626397_at:122:337; Interrogation_Position=27055; Antisense; GCTCATCAAAAGTCACATTCATCAT
>probe:Drosophila_2:1626397_at:34:683; Interrogation_Position=27138; Antisense; TATGCATTTCAACCAAATCGTCCAT
>probe:Drosophila_2:1626397_at:177:235; Interrogation_Position=27153; Antisense; AATCGTCCATAATTGGGCAACATTA
>probe:Drosophila_2:1626397_at:314:445; Interrogation_Position=27291; Antisense; GATGAACTCACAGGTACTGATCGAA
>probe:Drosophila_2:1626397_at:188:137; Interrogation_Position=27320; Antisense; ACGAGATCTTCGCTACTTGAGTGAC
>probe:Drosophila_2:1626397_at:85:341; Interrogation_Position=27331; Antisense; GCTACTTGAGTGACTTCTGGCATCC
>probe:Drosophila_2:1626397_at:242:403; Interrogation_Position=27342; Antisense; GACTTCTGGCATCCTCAACAATAAG
>probe:Drosophila_2:1626397_at:250:663; Interrogation_Position=27370; Antisense; TAAACCTCATTAGCCATTCAAGTAG
>probe:Drosophila_2:1626397_at:148:679; Interrogation_Position=27392; Antisense; TAGTTGCAAACTCTACTTCTCGGAC
>probe:Drosophila_2:1626397_at:184:399; Interrogation_Position=27446; Antisense; GACAAATATGTAGTGCGCGGGCTCT
>probe:Drosophila_2:1626397_at:261:507; Interrogation_Position=27458; Antisense; GTGCGCGGGCTCTATTTGACATAAA

Paste this into a BLAST search page for me
AAGTATTTGTGCGTTCTCGATGAACATGAACGTTCACACAGCGGAATCCTGCGGAATCCTAAGCTACTTCGGATAGCTCATCAAAAGTCACATTCATCATTATGCATTTCAACCAAATCGTCCATAATCGTCCATAATTGGGCAACATTAGATGAACTCACAGGTACTGATCGAAACGAGATCTTCGCTACTTGAGTGACGCTACTTGAGTGACTTCTGGCATCCGACTTCTGGCATCCTCAACAATAAGTAAACCTCATTAGCCATTCAAGTAGTAGTTGCAAACTCTACTTCTCGGACGACAAATATGTAGTGCGCGGGCTCTGTGCGCGGGCTCTATTTGACATAAA

Full Affymetrix probeset data:

Annotations for 1626397_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime